MirGeneDB

MirGeneDB ID

Isc-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-2001
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS758004: 38916-38977 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCCCGUGGUGCCGCAGUGUCCUGGCCGCCUUGUGACCGUUACAAUGGGCAUGUUGGUCCACGUGCAGAUGCCCACUGUCACGUUCACUGGGCGGACACGGCGCUCACUCGCCGACCAGGUG
Get precursor sequence
Structure
        10          20        30        40        50        60
ACCCCGUGGUGCCGCAGU--|  C  G      U    C   U   A       GUUGGUC 
                    GUC UG CCGCCU GUGA CGU ACA UGGGCAU       C
                    CGG AC GGCGGG CACU GCA UGU ACCCGUA       A
GUGGACCAGCCGCUCACUCG^  C  A      U    U   C   C       GACGUGC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 on the 3p arm relative to what is shown here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-2001_5p

MirBase accessionMIMAT0009721
Sequence
0- UUGUGACCGUUACAAUGGGCAU -22
Get sequence
Star sequence

Isc-Mir-2001_3p*

MirBase accessionNone
Sequence
40- GCCCACUGUCACGUUCACUGGG -62
Get sequence