MirGeneDB

MirGeneDB ID

Lgi-Mir-71

Family name MIR-71 (all species)
Seed GAAAGAC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-71
Paralogues
Orthologues Aae-Mir-71  Asu-Mir-71  Bfl-Mir-71  Bge-Mir-71  Cbr-Mir-71  Cel-Mir-71  Cgi-Mir-71  Cte-Mir-71  Dpu-Mir-71  Efe-Mir-71-P1  Efe-Mir-71-P2  Efe-Mir-71-P3  Hme-Mir-71  Isc-Mir-71  Lan-Mir-71-P4  Lan-Mir-71-P5  Pfl-Mir-71  Pmi-Mir-71  Sko-Mir-71  Spu-Mir-71  Tca-Mir-71 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_2: 4515804-4515862 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-71)
Mir-2-o27a LOTGIsca_2: 4514963-4515021 [-] Ensembl
Mir-2-o27b LOTGIsca_2: 4515158-4515216 [-] Ensembl
Mir-71 LOTGIsca_2: 4515804-4515862 [-] Ensembl
Mir-2-o14 LOTGIsca_2: 4520084-4520140 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCAGUCUACCAUGCAGCAGAAAUCUUUGUGAAAGACAAGGGUAGUGAGAUGAUUCAAUAAUACCAUCUUACUACUCUGUCUUUUGCAUAGAUUUUUGGAUAUCAUCAAUUUGUGGUU
Get precursor sequence
Structure
        10          20        30        40        50         
CCCCAGUCUACCAUGCAG--|        U  UG       A             AUUCA 
                    CAGAAAUCU UG  AAAGACA GGGUAGUGAGAUG     A
                    GUUUUUAGA AC  UUUCUGU CUCAUCAUUCUAC     U
UUGGUGUUUAACUACUAUAG^        U  GU       -             CAUAA 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-71_5p

MirBase accessionMIMAT0009571
Sequence
0- UGAAAGACAAGGGUAGUGAGAUG -23
Get sequence
Star sequence

Lgi-Mir-71_3p* (predicted)

MirBase accessionNone
Sequence
37- UCUUACUACUCUGUCUUUUGCA -59
Get sequence