MirGeneDB

MirGeneDB ID

Cte-Mir-36

Family name MIR-36 (all species)
Seed CACCGGG
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-36
Paralogues
Orthologues Asu-Mir-36-o27  Asu-Mir-36-o28  Asu-Mir-36-o29-v1  Asu-Mir-36-o29-v2  Asu-Mir-36-o30  Asu-Mir-36-o31  Asu-Mir-36-o32  Bge-Mir-36  Cbr-Mir-36-o1  Cbr-Mir-36-o2  Cbr-Mir-36-o3  Cbr-Mir-36-o4  Cbr-Mir-36-o5  Cbr-Mir-36-o6  Cbr-Mir-36-o7a  Cbr-Mir-36-o7b  Cbr-Mir-36-o7c  Cbr-Mir-36-o8a  Cbr-Mir-36-o8b  Cbr-Mir-36-o8c  Cbr-Mir-36-o9  Cbr-Mir-36-o10  Cbr-Mir-36-o11  Cbr-Mir-36-o12  Cbr-Mir-36-o13  Cbr-Mir-36-o14  Cbr-Mir-36-o15  Cbr-Mir-36-o16  Cbr-Mir-36-o17  Cbr-Mir-36-o18  Cbr-Mir-36-o19  Cbr-Mir-36-o20  Cbr-Mir-36-o21  Cbr-Mir-36-o22  Cbr-Mir-36-o23  Cbr-Mir-36-o24  Cbr-Mir-36-o25  Cbr-Mir-36-o26  Cel-Mir-36-P1  Cel-Mir-36-P2  Cel-Mir-36-P3  Cel-Mir-36-P4  Cel-Mir-36-P5  Cel-Mir-36-P6  Cel-Mir-36-P7  Cel-Mir-36-P8  Cgi-Mir-36  Dpu-Mir-36  Efe-Mir-36-P9  Efe-Mir-36-P10  Tca-Mir-36 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_19: 701730-701789 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-36)
Mir-36 CAPTEscaffold_19: 701730-701789 [-] Ensembl
Mir-279-o11 CAPTEscaffold_19: 703521-703582 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCGGAACUUGACACACUUAUGUCUACUCCCUGUGGGUGUUAACUCGGUCAGAUGCUAAUUUAUUUCCAUCACCGGGUUAACAUUCAUCCGGGAAGGCCAUACAAAUCUACAACAGAACAU
Get precursor sequence
Structure
        10          20         30         40        50        60
GCGGAACUUGACACACU--   -|   AC    U-                 CA    CUAAU 
                   UAU GUCU  UCCC  GUGGGUGUUAACUCGGU  GAUG     U
                   AUA CGGA  AGGG  UACUUACAAUUGGGCCA  CUAC     U
UACAAGACAACAUCUAAAC   C^   --    CC                 --    CUUUA 
.       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cte-Mir-36_5p* (predicted)

MirBase accessionNone
Sequence
0- UGUGGGUGUUAACUCGGUCAGAUG -24
Get sequence
Mature sequence

Cte-Mir-36_3p

MirBase accessionMIMAT0013530
Sequence
38- UCACCGGGUUAACAUUCAUCCG -60
Get sequence