MirGeneDB

MirGeneDB ID

Spu-Mir-153

Family name MIR-153 (all species)
Seed UGCAUAG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-153
Paralogues
Orthologues Aca-Mir-153-P1  Aca-Mir-153-P2  Ami-Mir-153-P1  Ami-Mir-153-P2  Bfl-Mir-153  Bta-Mir-153-P1  Bta-Mir-153-P2  Cfa-Mir-153-P1  Cfa-Mir-153-P2  Cgi-Mir-153  Cin-Mir-153  Cli-Mir-153-P1  Cli-Mir-153-P2  Cpi-Mir-153-P1  Cpi-Mir-153-P2  Cpo-Mir-153-P2  Cte-Mir-153  Dno-Mir-153-P1  Dno-Mir-153-P2  Dpu-Mir-153  Dre-Mir-153-P1a  Dre-Mir-153-P1b  Dre-Mir-153-P2  Efe-Mir-153-P5  Efe-Mir-153-P6  Ete-Mir-153-P2  Gga-Mir-153-P2  Hsa-Mir-153-P1  Hsa-Mir-153-P2  Isc-Mir-153  Lan-Mir-153  Lgi-Mir-153  Mdo-Mir-153-P1  Mdo-Mir-153-P2  Mml-Mir-153-P1  Mml-Mir-153-P2  Mmu-Mir-153-P2  Oan-Mir-153-P1  Oan-Mir-153-P2  Ocu-Mir-153-P2  Pfl-Mir-153  Pmi-Mir-153  Rno-Mir-153-P2  Sha-Mir-153-P1  Sha-Mir-153-P2  Sko-Mir-153  Sto-Mir-153-P1  Sto-Mir-153-P2  Sto-Mir-153-P3  Tgu-Mir-153-P1  Tgu-Mir-153-P2  Xtr-Mir-153-P1  Xtr-Mir-153-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold360: 60693-60761 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCCAUAAUCCAUCAUUCCCGCCAGCCCGAUCAUUUUUGUGUUUAUGCAACUUUUGUAUUUUCACCGAUCAGAGUAGUUGCAUAGUCACAAAAGUGAUUGGGAGGGUUGGGCUCUAACAUCUAUGCAAC
Get precursor sequence
Structure
        10         20         30        40        50        60    
ACCCAUAAUCCAUCAUU-   -|  AG                U          UUUGUAUUUUC 
                  CCC GCC  CCCGAUCAUUUUUGUG UUAUGCAACU           \
                  GGG UGG  GGGUUAGUGAAAACAC GAUACGUUGA           A
CAACGUAUCUACAAUCUC   U^  GA                U          UGAGACUAGCC 
       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-153_5p*

MirBase accessionMIMAT0019162
Sequence
0- UCAUUUUUGUGUUUAUGCAACU -22
Get sequence
Mature sequence

Spu-Mir-153_3p

MirBase accessionMIMAT0009669
Sequence
47- UUGCAUAGUCACAAAAGUGAUU -69
Get sequence