MirGeneDB

MirGeneDB ID

Aca-Mir-153-P1

Family name MIR-153 (all species)
Seed UGCAUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-153-2
Paralogues Aca-Mir-153-P2 
Orthologues Ami-Mir-153-P1  Bfl-Mir-153  Bta-Mir-153-P1  Cfa-Mir-153-P1  Cgi-Mir-153  Cin-Mir-153  Cli-Mir-153-P1  Cpi-Mir-153-P1  Cte-Mir-153  Dno-Mir-153-P1  Dpu-Mir-153  Dre-Mir-153-P1a  Dre-Mir-153-P1b  Hsa-Mir-153-P1  Isc-Mir-153  Lan-Mir-153  Lgi-Mir-153  Mdo-Mir-153-P1  Mml-Mir-153-P1  Oan-Mir-153-P1  Pfl-Mir-153  Pmi-Mir-153  Sha-Mir-153-P1  Sko-Mir-153  Spu-Mir-153  Sto-Mir-153-P1  Tgu-Mir-153-P1  Xtr-Mir-153-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
1: 95540877-95540935 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUCUCUCUUUCUUUCACAGCCGUCAGUGUCAUUUUUGUGAUUUGCAGCUAGUAAUCCUGGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGCCGCUGUGCCAGCUGCAUGGAACAG
Get precursor sequence
Structure
        10         20        30         40         50        
UUUUCUCUCUUUCUUUC-     C       -              -|      AGUAAU 
                  ACAGC GUCAGUG UCAUUUUUGUGAUU UGCAGCU      C
                  UGUCG CGGUUAC AGUGAAAACACUGA ACGUUGA      C
GACAAGGUACGUCGACCG     C       U              U^      CCCGGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-153-P1_5p*

MirBase accessionMIMAT0021787
Sequence
0- UCAUUUUUGUGAUUUGCAGCU -21
Get sequence
Mature sequence

Aca-Mir-153-P1_3p

MirBase accessionMIMAT0021786
Sequence
37- UUGCAUAGUCACAAAAGUGAUC -59
Get sequence