MirGeneDB

MirGeneDB ID

Lgi-Mir-153

Family name MIR-153 (all species)
Seed UGCAUAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-153
Paralogues
Orthologues Aca-Mir-153-P1  Aca-Mir-153-P2  Ami-Mir-153-P1  Ami-Mir-153-P2  Bfl-Mir-153  Bta-Mir-153-P1  Bta-Mir-153-P2  Cfa-Mir-153-P1  Cfa-Mir-153-P2  Cgi-Mir-153  Cin-Mir-153  Cli-Mir-153-P1  Cli-Mir-153-P2  Cpi-Mir-153-P1  Cpi-Mir-153-P2  Cpo-Mir-153-P2  Cte-Mir-153  Dno-Mir-153-P1  Dno-Mir-153-P2  Dpu-Mir-153  Dre-Mir-153-P1a  Dre-Mir-153-P1b  Dre-Mir-153-P2  Efe-Mir-153-P5  Efe-Mir-153-P6  Ete-Mir-153-P2  Gga-Mir-153-P2  Hsa-Mir-153-P1  Hsa-Mir-153-P2  Isc-Mir-153  Lan-Mir-153  Mdo-Mir-153-P1  Mdo-Mir-153-P2  Mml-Mir-153-P1  Mml-Mir-153-P2  Mmu-Mir-153-P2  Oan-Mir-153-P1  Oan-Mir-153-P2  Ocu-Mir-153-P2  Pfl-Mir-153  Pmi-Mir-153  Rno-Mir-153-P2  Sha-Mir-153-P1  Sha-Mir-153-P2  Sko-Mir-153  Spu-Mir-153  Sto-Mir-153-P1  Sto-Mir-153-P2  Sto-Mir-153-P3  Tgu-Mir-153-P1  Tgu-Mir-153-P2  Xtr-Mir-153-P1  Xtr-Mir-153-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
934768777_BGOB62773: 183-240 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGCUUUGGGCUCUAACUUCAUUUUCCCGGGCAGCUUUUGUGAUUUAGCAAUUGUGACUUUUGCAAAUUGCAUAGUCACAAAAGUGAUCGGGGAGGUGGAACAAUCCACUAACACUUGC
Get precursor sequence
Structure
        10           20        30        40        50        
GGCUUUGGGCUCUAACU---|           GCA            UA      GUGAC 
                    UCAUUUUCCCGG   GCUUUUGUGAUU  GCAAUU     U
                    GGUGGAGGGGCU   UGAAAACACUGA  CGUUAA     U
CGUUCACAAUCACCUAACAA^           AG-            UA      ACGUU 
      110       100        90         80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive (BGOB62773.y1).
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Lgi-Mir-153_5p* (predicted)

MirBase accessionNone
Sequence
0- CAGCUUUUGUGAUUUAGCAAUU -22
Get sequence
Mature sequence

Lgi-Mir-153_3p

MirBase accessionMIMAT0009582
Sequence
36- UUGCAUAGUCACAAAAGUGAUC -58
Get sequence