MirGeneDB

MirGeneDB ID

Aca-Mir-153-P2

Family name MIR-153 (all species)
Seed UGCAUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-153-1
Paralogues Aca-Mir-153-P1 
Orthologues Ami-Mir-153-P2  Bfl-Mir-153  Bta-Mir-153-P2  Cfa-Mir-153-P2  Cgi-Mir-153  Cin-Mir-153  Cli-Mir-153-P2  Cpi-Mir-153-P2  Cpo-Mir-153-P2  Cte-Mir-153  Dno-Mir-153-P2  Dpu-Mir-153  Dre-Mir-153-P2  Ete-Mir-153-P2  Gga-Mir-153-P2  Hsa-Mir-153-P2  Isc-Mir-153  Lan-Mir-153  Lgi-Mir-153  Mdo-Mir-153-P2  Mml-Mir-153-P2  Mmu-Mir-153-P2  Oan-Mir-153-P2  Ocu-Mir-153-P2  Pfl-Mir-153  Pmi-Mir-153  Rno-Mir-153-P2  Sha-Mir-153-P2  Sko-Mir-153  Spu-Mir-153  Sto-Mir-153-P2  Tgu-Mir-153-P2  Xtr-Mir-153-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
6: 6762624-6762684 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAUUUUGCCAGCUAAUUAGCGGUUGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUAAGCCAAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUGACUCUGCUGCAGGGACA
Get precursor sequence
Structure
        10        20        30         40        50        60
UAUUUUGCCAGCUAAUUA      G      -|            GU       AGUAAU 
                  GCGGUU CCAGUG UCAUUUUUGUGAU  UGCAGCU      A
                  UGUCAA GGUUAC AGUGAAAACACUG  ACGUUGA      U
ACAGGGACGUCGUCUCAG      A      U^            AU       ACCGAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-153-P2_5p*

MirBase accessionNone
Sequence
0- GUCAUUUUUGUGAUGUUGCAGCU -23
Get sequence
Mature sequence

Aca-Mir-153-P2_3p

MirBase accessionMIMAT0021786
Sequence
39- UUGCAUAGUCACAAAAGUGAUC -61
Get sequence