MirGeneDB

MirGeneDB ID

Lgi-Mir-22-P1

Family name MIR-22 (all species)
Seed GCUGCCU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-745a
Paralogues Lgi-Mir-22-P2 
Orthologues Aca-Mir-22-P1a  Bfl-Mir-22-P1  Bta-Mir-22-P1a  Cfa-Mir-22-P1a  Cgi-Mir-22-P1  Cli-Mir-22-P1a  Cpi-Mir-22-P1a  Cpo-Mir-22-P1a  Cte-Mir-22-P1  Dno-Mir-22-P1a  Dre-Mir-22-P1a  Dre-Mir-22-P1b  Efe-Mir-22-P1c  Efe-Mir-22-P1d  Ete-Mir-22-P1a  Gga-Mir-22-P1a  Hsa-Mir-22-P1a  Lan-Mir-22-P1  Mdo-Mir-22-P1a  Mml-Mir-22-P1a  Mmu-Mir-22-P1a  Oan-Mir-22-P1a  Ocu-Mir-22-P1a  Pfl-Mir-22-P1  Pmi-Mir-22-P1  Rno-Mir-22-P1a  Sha-Mir-22-P1a  Sto-Mir-22-P1a  Sto-Mir-22-P1b  Xtr-Mir-22-P1a 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_20: 381451-381510 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-22-P1)
Mir-22-P1 LOTGIsca_20: 381451-381510 [+] Ensembl
Mir-22-P2 LOTGIsca_20: 382169-382227 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAUAUACAGCACAAAGAAUCUGUUGGAUUAUCGGCCCUUCUUCAGGUAGACUUGAUCAUUUCAAACAAGCUGCCUGAUGAAGAGCUGUACAAUCUUCCAGUCAUAUCAACACCUUGUAUC
Get precursor sequence
Structure
        10         20        30         40        50          
CAUAUACAGCACAAAGAAU-   UU     AU-|   C    U        A    AUCAU 
                    CUG  GGAUU   CGGC CUUC UCAGGUAG CUUG     \
                    GAC  UCUAA   GUCG GAAG AGUCCGUC GAAC     U
CUAUGUUCCACAACUAUACU   CU     CAU^   A    U        -    AAACU 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-22-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- UCGGCCCUUCUUCAGGUAGACUUG -24
Get sequence
Mature sequence

Lgi-Mir-22-P1_3p

MirBase accessionMIMAT0009598
Sequence
37- AGCUGCCUGAUGAAGAGCUGUAC -60
Get sequence