MirGeneDB

MirGeneDB ID

Sto-Mir-22-P1a

Family name MIR-22 (all species)
Seed AGCUGCC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-22-P1b 
Orthologues Aca-Mir-22-P1a  Bfl-Mir-22-P1  Bta-Mir-22-P1a  Cfa-Mir-22-P1a  Cgi-Mir-22-P1  Cli-Mir-22-P1a  Cpi-Mir-22-P1a  Cpo-Mir-22-P1a  Cte-Mir-22-P1  Dno-Mir-22-P1a  Dre-Mir-22-P1a  Ete-Mir-22-P1a  Gga-Mir-22-P1a  Hsa-Mir-22-P1a  Lan-Mir-22-P1  Lgi-Mir-22-P1  Mdo-Mir-22-P1a  Mml-Mir-22-P1a  Mmu-Mir-22-P1a  Oan-Mir-22-P1a  Ocu-Mir-22-P1a  Pfl-Mir-22-P1  Pmi-Mir-22-P1  Rno-Mir-22-P1a  Sha-Mir-22-P1a  Xtr-Mir-22-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01000512.1: 189391-189453 [+]
Precursor
(pre-Mir +30nt flank)
UUCCAUUAAUUACUCUGGCUAUCCUACAGCCGUUCUUCACUGGCUAGUUUUAUGUCACUGUCAAACAGCUAAAGCUGCCAGUUGAAGAACUGUUGAGGUUGGCUAUUUGCGACAGGACACUGA
Get precursor sequence
Structure
        10           20        30         40        50        60 
UUCCAUUAAUUACUCUG---|   U   A    C        -     U       UGUCACUG 
                    GCUA CCU CAGC GUUCUUCA CUGGC AGUUUUA        \
                    CGGU GGA GUUG CAAGAAGU GACCG UCGAAAU        U
AGUCACAGGACAGCGUUUAU^   U   -    U        U     -       CGACAAAC 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-22-P1a_5p*

MirBase accessionNone
Sequence
0- CGUUCUUCACUGGCUAGUUUUA -22
Get sequence
Mature sequence

Sto-Mir-22-P1a_3p

MirBase accessionNone
Sequence
41- AAGCUGCCAGUUGAAGAACUGU -63
Get sequence