MirGeneDB

MirGeneDB ID

Isc-Mir-277

Family name MIR-277 (all species)
Seed AAAUGCA
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues
Orthologues Aae-Mir-277  Bge-Mir-277  Cbr-Mir-277-P1  Cbr-Mir-277-P2  Cel-Mir-277  Cgi-Mir-277  Cte-Mir-277-P1  Cte-Mir-277-P2  Dan-Mir-277  Dme-Mir-277  Dmo-Mir-277  Dpu-Mir-277  Efe-Mir-277  Hme-Mir-277  Lan-Mir-277-P3  Lan-Mir-277-P4  Lan-Mir-277-P5  Lgi-Mir-277  Tca-Mir-277 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS891538: 51143-51205 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GUUUAUCCUGGCUCAGCGCGCGGGUGGCUUCGUUCCAGUGUUGCAUUUACAAUGUGACGUAGCGAUGGCUGUAAAUGCAUUAUCUGGAAUGCAAGGCGUCCGCGCCCGCUCUCCUCCUCCGCC
Get precursor sequence
Structure
        10         20        30         40         50        60
GUUUAUCCUGGCUCAGC-      GU G   -        UGU-|         AUGUGACG 
                  GCGCGG  G CUU CGUUCCAG    UGCAUUUACA        U
                  CGCGCC  C GAA GUAAGGUC    ACGUAAAUGU        A
CCGCCUCCUCCUCUCGCC      UG G   C        UAUU^         CGGUAGCG 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-277_5p*

MirBase accessionNone
Sequence
0- CGUUCCAGUGUUGCAUUUACA -21
Get sequence
Mature sequence

Isc-Mir-277_3p

MirBase accessionNone
Sequence
41- UAAAUGCAUUAUCUGGAAUGCA -63
Get sequence