MirGeneDB

MirGeneDB ID

Dan-Mir-277

Family name MIR-277 (all species)
Seed AAAUGCA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-277
Paralogues
Orthologues Aae-Mir-277  Bge-Mir-277  Cbr-Mir-277-P1  Cbr-Mir-277-P2  Cel-Mir-277  Cgi-Mir-277  Cte-Mir-277-P1  Cte-Mir-277-P2  Dme-Mir-277  Dmo-Mir-277  Dpu-Mir-277  Efe-Mir-277  Hme-Mir-277  Isc-Mir-277  Lan-Mir-277-P3  Lan-Mir-277-P4  Lan-Mir-277-P5  Lgi-Mir-277  Tca-Mir-277 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 6489013-6489076 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-277)
Mir-317 scaffold_13340: 6480005-6480070 [+] Ensembl
Mir-277 scaffold_13340: 6489013-6489076 [+] Ensembl
Mir-34 scaffold_13340: 6489998-6490072 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAAUGCAUCCUUUGAAGGUUUUGGGCUGCGUGUCAGGAGUGCAUUUGCACUGAAACAUUCUGAAGCUUGUAAAUGCACUAUCUGGUACGACAUUCCAGAACGUACAAUCUUCCCGAAUGCAA
Get precursor sequence
Structure
        10          20        30          40        50        60
AAAAAUGCAUCCUUUGAAG--       GC  -   GU    -|           CUGAAACA 
                     GUUUUGG  UG CGU  CAGG AGUGCAUUUGCA        U
                     CAAGACC  AC GCA  GUCU UCACGUAAAUGU        U
AACGUAAGCCCUUCUAACAUG       UU  A   UG    A^           UCGAAGUC 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-277_5p*

MirBase accessionNone
Sequence
0- CGUGUCAGGAGUGCAUUUGCA -21
Get sequence
Mature sequence

Dan-Mir-277_3p

MirBase accessionMIMAT0008407
Sequence
41- UAAAUGCACUAUCUGGUACGACA -64
Get sequence