MirGeneDB

MirGeneDB ID

Dan-Mir-317

Family name MIR-317 (all species)
Seed GAACACA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-317
Paralogues
Orthologues Aae-Mir-317-P8  Aae-Mir-317-P9  Bge-Mir-317  Cgi-Mir-317-P1  Cgi-Mir-317-P2  Cte-Mir-317  Dme-Mir-317  Dmo-Mir-317  Dpu-Mir-317  Efe-Mir-317-P5  Efe-Mir-317-P6  Efe-Mir-317-P7  Hme-Mir-317  Isc-Mir-317  Lan-Mir-317-P10  Lan-Mir-317-P11  Lgi-Mir-317  Tca-Mir-317 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 6480005-6480070 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-317)
Mir-317 scaffold_13340: 6480005-6480070 [+] Ensembl
Mir-277 scaffold_13340: 6489013-6489076 [+] Ensembl
Mir-34 scaffold_13340: 6489998-6490072 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCGAAAAGCUCAUUUGUGUGCAUCGGCUGCUGGGAUACACCCUGUGCUCGCUUUGAAUGAAAUGCAAGCAAGUGAACACAGCUGGUGGUAUCCAGUGGCCGUUUUGCAUCCUUUCAACUUCAAGGA
Get precursor sequence
Structure
        10        20          30        40          50        60 
GCGAAAAGCUCAUUUGUG    U--    UG     AUA    --|    C     UUGAAUGA 
                  UGCA   CGGC  CUGGG   CACC  CUGUG UCGCU        A
                  ACGU   GCCG  GACCU   GUGG  GACAC AGUGA        A
AGGAACUUCAACUUUCCU    UUU    GU     AUG    UC^    A     ACGAACGU 
    120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Da
Star sequence

Dan-Mir-317_5p*

MirBase accessionNone
Sequence
0- UGGGAUACACCCUGUGCUCGCU -22
Get sequence
Mature sequence

Dan-Mir-317_3p

MirBase accessionMIMAT0008452
Sequence
42- UGAACACAGCUGGUGGUAUCCAGU -66
Get sequence