MirGeneDB

MirGeneDB ID

Isc-Mir-317

Family name MIR-317 (all species)
Seed GAACACA
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-317
Paralogues
Orthologues Aae-Mir-317-P8  Aae-Mir-317-P9  Bge-Mir-317  Cgi-Mir-317-P1  Cgi-Mir-317-P2  Cte-Mir-317  Dan-Mir-317  Dme-Mir-317  Dmo-Mir-317  Dpu-Mir-317  Efe-Mir-317-P5  Efe-Mir-317-P6  Efe-Mir-317-P7  Hme-Mir-317  Lan-Mir-317-P10  Lan-Mir-317-P11  Lgi-Mir-317  Tca-Mir-317 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS891538: 57439-57502 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAGUGUGACUUCGACAUGGCCUCGCCUGACAGUGUACCACCCUGAGUUCCCACGUGCGUUUGCCCAGUGUGAACACAGCUGGUGGUAUAUCAGUCAGUCGCGGCAUCUACGCUUCCCUGCGCUG
Get precursor sequence
Structure
        10          20        30         40          50          
GAGUGUGACUUCGACAUG--   U  C     A-          --|  A    C  CGUGCGU 
                    GCC CG CUGAC  GUGUACCACC  CUG GUUC CA       \
                    CGG GC GACUG  UAUAUGGUGG  GAC CAAG GU       U
GUCGCGUCCCUUCGCAUCUA   C  U     AC          UC^  A    U  GACCCGU 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-317_5p*

MirBase accessionNone
Sequence
0- AGUGUACCACCCUGAGUUCCCA -22
Get sequence
Mature sequence

Isc-Mir-317_3p

MirBase accessionMIMAT0012699
Sequence
39- UGAACACAGCUGGUGGUAUAUCAGU -64
Get sequence