MirGeneDB

MirGeneDB ID

Tca-Mir-317

Family name MIR-317 (all species)
Seed GAACACA
Species Red flour beetle (Tribolium castaneum)
MiRBase ID tca-mir-317
Paralogues
Orthologues Aae-Mir-317-P8  Aae-Mir-317-P9  Bge-Mir-317  Cgi-Mir-317-P1  Cgi-Mir-317-P2  Cte-Mir-317  Dan-Mir-317  Dme-Mir-317  Dmo-Mir-317  Dpu-Mir-317  Efe-Mir-317-P5  Efe-Mir-317-P6  Efe-Mir-317-P7  Hme-Mir-317  Isc-Mir-317  Lan-Mir-317-P10  Lan-Mir-317-P11  Lgi-Mir-317 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Tcas5.2)
LG7: 14490230-14490291 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-317)
Mir-317 LG7: 14490230-14490291 [+] Ensembl
Mir-277 LG7: 14498469-14498537 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGACCGAAUCUGCUGAAGGUGGGGCGGUGCUGGGGACCACCCUGUGUUUACUCUGUAUUUCGACCAGUGAACACAGCUGGUGGUAUCUCAGUUUCUUCCCAUCAAUGACAACCAAACACCAA
Get precursor sequence
Structure
        10          20        30         40          50         
AGACCGAAUCUGCUGAA--       C  U       -      --|          CUGUAU 
                   GGUGGGG GG GCUGGGG ACCACC  CUGUGUUUACU      \
                   CUACCCU CU UGACUCU UGGUGG  GACACAAGUGA      U
AACCACAAACCAACAGUAA       U  U       A      UC^          CCAGCU 
120       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Fe Fe Fe Fe Oo
Star sequence

Tca-Mir-317_5p*

MirBase accessionMIMAT0019130
Sequence
0- UGGGGACCACCCUGUGUUUACU -22
Get sequence
Mature sequence

Tca-Mir-317_3p

MirBase accessionMIMAT0008390
Sequence
37- UGAACACAGCUGGUGGUAUCUCAGU -62
Get sequence