MirGeneDB

MirGeneDB ID

Cbr-Mir-29-P1

Family name MIR-29 (all species)
Seed AGCACCA
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-83
Paralogues Cbr-Mir-29-P2 
Orthologues Aae-Mir-29-P1d  Aca-Mir-29-P1a  Aca-Mir-29-P1b  Ami-Mir-29-P1a  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bge-Mir-29-P1c  Bge-Mir-29-P1d  Bta-Mir-29-P1a  Bta-Mir-29-P1b  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cli-Mir-29-P1b  Cpi-Mir-29-P1a  Cpi-Mir-29-P1b  Cpo-Mir-29-P1a  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dan-Mir-29-P1c  Dan-Mir-29-P1d  Dme-Mir-29-P1c  Dme-Mir-29-P1d  Dmo-Mir-29-P1c  Dmo-Mir-29-P1d  Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dpu-Mir-29-P1c  Dpu-Mir-29-P1d  Dre-Mir-29-P1a  Efe-Mir-29-P1e  Efe-Mir-29-P1f  Ete-Mir-29-P1a  Ete-Mir-29-P1b  Gga-Mir-29-P1a  Gga-Mir-29-P1b  Hme-Mir-29-P1d  Hsa-Mir-29-P1a  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lan-Mir-29-P1g  Lan-Mir-29-P1h  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mdo-Mir-29-P1b  Mml-Mir-29-P1a  Mml-Mir-29-P1b  Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Oan-Mir-29-P1a  Oan-Mir-29-P1b  Ocu-Mir-29-P1a  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1a  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Sto-Mir-29-P1b  Tca-Mir-29-P1c  Tca-Mir-29-P1d  Tgu-Mir-29-P1a  Tgu-Mir-29-P1b  Xtr-Mir-29-P1a  Xtr-Mir-29-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(CB4)
IV: 11660111-11660175 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AGGAAGCAGCAGAAGGCACCACUCGAAAAAACUGAGUUUAUGUGUGUACUUGACGGCGAUCAGAGCAACGAUCUAGCACCAUAUAAAUUCAGUGUUUUCGUGGACAGAGAGCCAAGUUUUUAUAU
Get precursor sequence
Structure
        10            20        30        40        50        60  
AGGAAGCAGCAGAAGGCA----|   UC     A              U  A  U  CGGCGAUC 
                      CCAC  GAAAA ACUGAGUUUAUGUG GU CU GA        A
                      GGUG  CUUUU UGACUUAAAUAUAC CA GA CU        G
UAUAUUUUUGAACCGAGAGACA^   --     G              -  C  U  AGCAACGA 
   120       110       100          90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence

Cbr-Mir-29-P1_5p*

MirBase accessionNone
Sequence
0- ACUGAGUUUAUGUGUGUACUUGA -23
Get sequence
Mature sequence

Cbr-Mir-29-P1_3p

MirBase accessionMIMAT0001295
Sequence
43- UAGCACCAUAUAAAUUCAGUGU -65
Get sequence