MirGeneDB

MirGeneDB ID

Sto-Mir-29-P1b

Family name MIR-29 (all species)
Seed AGCACCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-29-P1a  Sto-Mir-29-P2a  Sto-Mir-29-P2b 
Orthologues Aca-Mir-29-P1b  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1b  Cpi-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Gga-Mir-29-P1b  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Tgu-Mir-29-P1b  Xtr-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01000344.1: 172507-172566 [-]
Precursor
(pre-Mir +30nt flank)
CCAAAGACUCGUUCCCCUUUACCCAGGGUGACUGGUUUCUUCUGGUGUUCAGAGUCAUGGUUCAGUUCUAGCACCAUUUGAAAUCGGUUACAAUGCAGAGGGAAAGACUCCAAGAGUGGU
Get precursor sequence
Structure
        10        20             30        40        50          
CCAAAGACUCGUUCCCCUUUA   AGG-----|           UUC       C   GUCAUG 
                     CCC        GUGACUGGUUUC   UGGUGUU AGA      \
                     GGG        CAUUGGCUAAAG   ACCACGA UCU      G
UGGUGAGAACCUCAGAAA---   AGACGUAA^           UUU       -   UGACUU 
.       110          100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-29-P1b_5p*

MirBase accessionNone
Sequence
0- ACUGGUUUCUUCUGGUGUUCAGA -23
Get sequence
Mature sequence

Sto-Mir-29-P1b_3p

MirBase accessionNone
Sequence
38- UAGCACCAUUUGAAAUCGGUUA -60
Get sequence