MirGeneDB

MirGeneDB ID

Rno-Mir-34-P3b

Family name MIR-34 (all species)
Seed GGCAGUG
Species Norway rat (Rattus norvegicus)
MiRBase ID
Paralogues Rno-Mir-34-P1  Rno-Mir-34-P2a  Rno-Mir-34-P2b  Rno-Mir-34-P3a  Rno-Mir-34-P3c 
Orthologues Aae-Mir-34  Ami-Mir-34-P3b  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P3b  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P3b  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3b  Cpi-Mir-34-P3b  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dpu-Mir-34  Efe-Mir-34  Ete-Mir-34-P3b  Gga-Mir-34-P3b  Hsa-Mir-34-P3b  Lgi-Mir-34  Mdo-Mir-34-P3b  Mml-Mir-34-P3b  Mmu-Mir-34-P3b  Oan-Mir-34-P3b  Ocu-Mir-34-P3b  Pfl-Mir-34  Pmi-Mir-34  Sha-Mir-34-P3b  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Xtr-Mir-34-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr2: 44897502-44897562 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P3b)
Mir-34-P3c chr2: 44896085-44896148 [+] UCSC Ensembl
Mir-34-P3a chr2: 44897616-44897677 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGGAAAAUCAGCGCUUGCCAGACUCAGGUAGGCAGUGUGUUGUUAGCUGGCUGCGUUGGGUUAAGUAAGCAGCCACAGCUACCCUGCCACUUGCUUCUGGACGGGUCUUCUUGUUAAUGA
Get precursor sequence
Structure
        10          20        30         40        50        60  
CGGGAAAAUCAGCGCUUG--|    CU     A     U  -     UAGCU      GUUGGG 
                    CCAGA  CAGGU GGCAG GU GUUGU     GGCUGC      U
                    GGUCU  GUUCA CCGUC CA CGACA     CCGACG      U
AGUAAUUGUUCUUCUGGGCA^    UC     -     C  U     -----      AAUGAA 
 .       110       100        90         80             70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-34-P3b_5p

MirBase accessionNone
Sequence
0- AGGCAGUGUGUUGUUAGCUGGCUGCG -26
Get sequence
Star sequence

Rno-Mir-34-P3b_3p* (predicted)

MirBase accessionNone
Sequence
40- CAGCCACAGCUACCCUGCCAC -61
Get sequence