MirGeneDB

MirGeneDB ID

Rno-Mir-34-P3c

Family name MIR-34 (all species)
Seed GGCAGUG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-449c
Paralogues Rno-Mir-34-P1  Rno-Mir-34-P2a  Rno-Mir-34-P2b  Rno-Mir-34-P3a  Rno-Mir-34-P3b 
Orthologues Aae-Mir-34  Aca-Mir-34-P3c  Ami-Mir-34-P3c  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P3c  Cbr-Mir-34  Cel-Mir-34  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3c  Cpi-Mir-34-P3c  Cpo-Mir-34-P3c  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P3c  Dpu-Mir-34  Efe-Mir-34  Gga-Mir-34-P3c  Hsa-Mir-34-P3c  Lgi-Mir-34  Mmu-Mir-34-P3c  Oan-Mir-34-P3c  Pfl-Mir-34  Pmi-Mir-34  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P3c  Tca-Mir-34  Tgu-Mir-34-P3c  Xtr-Mir-34-P3c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr2: 44896085-44896148 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P3c)
Mir-34-P3c chr2: 44896085-44896148 [+] UCSC Ensembl
Mir-34-P3a chr2: 44897616-44897677 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUAGGGGACGAAGCGUGGGUGUGUCAGACAGGCAGUGCAUUGCUAGCUGGCUGUUAGAACUUCGUCCCAACAGUGGCUAGCUGCACUACCCUCUGCUGCACUUAGAAGCAUGCAAAGACGUGG
Get precursor sequence
Structure
        10           20        30        40        50        60   
CAUAGGGGACGAAGCGU---|      U    CA  C      UU        G     AGAACU 
                    GGGUGUG CAGA  GG AGUGCA  GCUAGCUG CUGUU      \
                    UUCACGU GUCU  CC UCACGU  CGAUCGGU GACAA      U
GGUGCAGAAACGUACGAAGA^      C    C-  A      --        -     CCCUGC 
  120       110       100         90          80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-34-P3c_5p

MirBase accessionMIMAT0017803
Sequence
0- AGGCAGUGCAUUGCUAGCUGGCUGUU -26
Get sequence
Validated targets TargetScanVert: rno-miR-449c-5p
miRDB: MIMAT0017803
Star sequence

Rno-Mir-34-P3c_3p* (predicted)

MirBase accessionMIMAT0017804
Sequence
41- CAGUGGCUAGCUGCACUACCCUC -64
Get sequence
Validated targets TargetScanVert: rno-miR-449c-3p
miRDB: MIMAT0017804