MirGeneDB

MirGeneDB ID

Aca-Mir-34-P3c

Family name MIR-34 (all species)
Seed GGCAGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-449b
Paralogues Aca-Mir-34-P1  Aca-Mir-34-P2a  Aca-Mir-34-P2b  Aca-Mir-34-P3a  Aca-Mir-34-P3d 
Orthologues Aae-Mir-34  Ami-Mir-34-P3c  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P3c  Cbr-Mir-34  Cel-Mir-34  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3c  Cpi-Mir-34-P3c  Cpo-Mir-34-P3c  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P3c  Dpu-Mir-34  Efe-Mir-34  Gga-Mir-34-P3c  Hsa-Mir-34-P3c  Lgi-Mir-34  Mmu-Mir-34-P3c  Oan-Mir-34-P3c  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P3c  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P3c  Tca-Mir-34  Tgu-Mir-34-P3c  Xtr-Mir-34-P3c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
2: 2663692-2663757 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P3c)
Mir-34-P3c 2: 2663692-2663757 [+] UCSC Ensembl
Mir-34-P3a 2: 2665578-2665639 [+] UCSC Ensembl
Mir-34-P3d 2: 2666240-2666298 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAUAAAAUGAAUAUGGGACUGUGUCGCUUUGGCAGUGCACUACUAGCUGGCUGUUGAGAUAUAUUCAUUUUUACAGUGGUUAGUUGCACUCCACACUGAUGCAGUCCAAAACACUGCAAGAGUAA
Get precursor sequence
Structure
        10          20        30        40        50        60    
AGAUAAAAUGAAUAUGG--|         CUU   C      CU        G    UGAGAUAU 
                   GACUGUGUCG   UGG AGUGCA  ACUAGCUG CUGU        A
                   CUGACGUAGU   ACC UCACGU  UGAUUGGU GACA        U
AAUGAGAACGUCACAAAAC^         CAC   -      --        -    UUUUUACU 
    120       110       100         90          80         70
Deep sequencing
Go to detailed chart
CommentThe Dicer site is -1 relative to most other vertebrates.
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-34-P3c_5p

MirBase accessionMIMAT0021959
Sequence
0- UGGCAGUGCACUACUAGCUGGCUGU -25
Get sequence
Star sequence

Aca-Mir-34-P3c_3p*

MirBase accessionNone
Sequence
45- AGUGGUUAGUUGCACUCCACA -66
Get sequence