MirGeneDB

MirGeneDB ID

Sto-Mir-34-P3c

Family name MIR-34 (all species)
Seed GGCAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-34-P1  Sto-Mir-34-P2a  Sto-Mir-34-P2b  Sto-Mir-34-P3a  Sto-Mir-34-P3d 
Orthologues Aae-Mir-34  Aca-Mir-34-P3c  Ami-Mir-34-P3c  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P3c  Cbr-Mir-34  Cel-Mir-34  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3c  Cpi-Mir-34-P3c  Cpo-Mir-34-P3c  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P3c  Dpu-Mir-34  Efe-Mir-34  Gga-Mir-34-P3c  Hsa-Mir-34-P3c  Lgi-Mir-34  Mmu-Mir-34-P3c  Oan-Mir-34-P3c  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P3c  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Tgu-Mir-34-P3c  Xtr-Mir-34-P3c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01003480.1: 102882-102945 [+]
Precursor
(pre-Mir +30nt flank)
GGAAGGGAAGGCAAGAAAGAUGUGGCGGUUAGGCAGUGUACUGCUAGCUGGCUGUUGUGUCUGACAGGUCAGCAGCUGCUAGCUACACUCCACACUGCUGCAUCUGAGAGCACUUCAUCAUCAG
Get precursor sequence
Structure
        10          20        30        40        50        60   
GGAAGGGAAGGCAAGAA--|    UG     UA  C      CU      U      UGUGUCU 
                   AGAUG  GCGGU  GG AGUGUA  GCUAGC GGCUGU       G
                   UCUAC  CGUCA  CC UCACAU  CGAUCG UCGACG       A
GACUACUACUUCACGAGAG^    GU     CA  -      --      -      ACUGGAC 
  120       110       100        90           80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-34-P3c_5p

MirBase accessionNone
Sequence
0- AGGCAGUGUACUGCUAGCUGGCUGU -25
Get sequence
Star sequence

Sto-Mir-34-P3c_3p*

MirBase accessionNone
Sequence
43- AGCUGCUAGCUACACUCCACA -64
Get sequence