MirGeneDB

MirGeneDB ID

Sto-Mir-34-P3d

Family name MIR-34 (all species)
Seed GGCAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-34-P1  Sto-Mir-34-P2a  Sto-Mir-34-P2b  Sto-Mir-34-P3a  Sto-Mir-34-P3c 
Orthologues Aae-Mir-34  Aca-Mir-34-P3d  Ami-Mir-34-P3d  Asu-Mir-34  Bge-Mir-34  Cbr-Mir-34  Cel-Mir-34  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3d  Cpi-Mir-34-P3d  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dpu-Mir-34  Efe-Mir-34  Gga-Mir-34-P3d  Lgi-Mir-34  Mdo-Mir-34-P3d  Pfl-Mir-34  Pmi-Mir-34  Sha-Mir-34-P3d  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Tgu-Mir-34-P3d 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01003480.1: 107524-107582 [+]
Precursor
(pre-Mir +30nt flank)
GAGGAACAAAUAGGUGUAUGUGUGUUGAUUAGGCAGUGUAAUGUUAGCUGGCUGCAACUCAAGAAUCAGCAGCUGCAUGCACCACCACAUCAGCUCAUGUCCUCACAACUGAACAAUUC
Get precursor sequence
Structure
        10          20        30        40        50        60
GAGGAACAAAUAGGUGU--|    U      UA  CA     A   U     G  GCAACU 
                   AUGUG GUUGAU  GG  GUGUA UGU AGCUG CU      C
                   UGUAC CGACUA  CC  CACGU ACG UCGAC GA      A
CUUAACAAGUCAACACUCC^    U      CA  AC     -   -     -  CUAAGA 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-34-P3d_5p

MirBase accessionNone
Sequence
0- AGGCAGUGUAAUGUUAGCUGGCU -23
Get sequence
Star sequence

Sto-Mir-34-P3d_3p* (predicted)

MirBase accessionNone
Sequence
38- GCAGCUGCAUGCACCACCACA -59
Get sequence