MirGeneDB

MirGeneDB ID

Sto-Mir-34-P3a

Family name MIR-34 (all species)
Seed GGCAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-34-P1  Sto-Mir-34-P2a  Sto-Mir-34-P2b  Sto-Mir-34-P3c  Sto-Mir-34-P3d 
Orthologues Aae-Mir-34  Aca-Mir-34-P3a  Ami-Mir-34-P3a  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P3a  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P3a  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3a  Cpi-Mir-34-P3a  Cpo-Mir-34-P3a  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P3a  Dpu-Mir-34  Efe-Mir-34  Ete-Mir-34-P3a  Gga-Mir-34-P3a  Hsa-Mir-34-P3a  Lgi-Mir-34  Mdo-Mir-34-P3a  Mml-Mir-34-P3a  Mmu-Mir-34-P3a  Oan-Mir-34-P3a  Ocu-Mir-34-P3a  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P3a  Sha-Mir-34-P3a  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Tgu-Mir-34-P3a  Xtr-Mir-34-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01003480.1: 106949-107010 [+]
Precursor
(pre-Mir +30nt flank)
GAGCUAAUGGUGUUUUUGUGCAUGGUGGUAAGGCAGUGUAACGUUAGCUGGUUGUAUCUAUCUAUAACACCGGUUAACUUACUGCUGCCCUCCUACCGUGCAUGCUUACUCUACCAUCAUCC
Get precursor sequence
Structure
        10          20        30         40        50        60
GAGCUAAUGGUGUUUUU--           UAA      -|   C          UGUAUCU 
                   GUGCAUGGUGG   GGCAGU GUAA GUUAGCUGGU       A
                   UACGUGCCAUC   CCGUCG CAUU CAAUUGGCCA       U
CCUACUACCAUCUCAUUCG           CUC      U^   -          CAAUAUC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-34-P3a_5p

MirBase accessionNone
Sequence
0- AGGCAGUGUAACGUUAGCUGGU -22
Get sequence
Star sequence

Sto-Mir-34-P3a_3p*

MirBase accessionNone
Sequence
40- CGGUUAACUUACUGCUGCCCUC -62
Get sequence