MirGeneDB

MirGeneDB ID

Sto-Mir-34-P1

Family name MIR-34 (all species)
Seed GGCAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-34-P2a  Sto-Mir-34-P2b  Sto-Mir-34-P3a  Sto-Mir-34-P3c  Sto-Mir-34-P3d 
Orthologues Aae-Mir-34  Aca-Mir-34-P1  Ami-Mir-34-P1  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P1  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P1  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P1  Cpi-Mir-34-P1  Cpo-Mir-34-P1  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P1  Dpu-Mir-34  Dre-Mir-34-P1  Efe-Mir-34  Ete-Mir-34-P1  Gga-Mir-34-P1  Hsa-Mir-34-P1  Lgi-Mir-34  Mdo-Mir-34-P1  Mml-Mir-34-P1  Mmu-Mir-34-P1  Oan-Mir-34-P1  Ocu-Mir-34-P1  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P1  Sha-Mir-34-P1  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Tgu-Mir-34-P1  Xtr-Mir-34-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01002753.1: 375841-375904 [+]
Precursor
(pre-Mir +30nt flank)
CUUUUCAUUGGCCAAAUGUGGGCGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGUGCAUUGCGAAAAAGCAAUCAGCAAGUAUACUGCCUCAGAAACACUUCACCGUAUCCGGCCCAACGCA
Get precursor sequence
Structure
        10         20         30         40        50        60 
CUUUUCAUUGGCCAAAU-   -  C      UU        -|  A          GUGUGCA 
                  GUG GG GUUUCU  GGCAGUGU CUU GCUGGUUGUU       U
                  CAC UC CAAAGA  CCGUCAUA GAA CGACUAACGA       U
ACGCAACCCGGCCUAUGC   U  A      CU        U^  -          AAAAGCG 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-34-P1_5p

MirBase accessionNone
Sequence
0- UGGCAGUGUCUUAGCUGGUUGUU -23
Get sequence
Star sequence

Sto-Mir-34-P1_3p*

MirBase accessionNone
Sequence
41- CAAUCAGCAAGUAUACUGCCUCA -64
Get sequence