MirGeneDB

MirGeneDB ID

Mmu-Mir-34-P1

Family name MIR-34 (all species)
Seed GGCAGUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-34a
Paralogues Mmu-Mir-34-P2a  Mmu-Mir-34-P2b  Mmu-Mir-34-P3a  Mmu-Mir-34-P3b  Mmu-Mir-34-P3c 
Orthologues Aae-Mir-34  Aca-Mir-34-P1  Ami-Mir-34-P1  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P1  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P1  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P1  Cpi-Mir-34-P1  Cpo-Mir-34-P1  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P1  Dpu-Mir-34  Dre-Mir-34-P1  Efe-Mir-34  Ete-Mir-34-P1  Gga-Mir-34-P1  Hsa-Mir-34-P1  Lgi-Mir-34  Mdo-Mir-34-P1  Mml-Mir-34-P1  Oan-Mir-34-P1  Ocu-Mir-34-P1  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P1  Sha-Mir-34-P1  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P1  Tca-Mir-34  Tgu-Mir-34-P1  Xtr-Mir-34-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr4: 150068473-150068538 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCUGGGCUGGCCAGCUGUGAGUAAUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGUAUUAGCUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACAUUGUUGGGCCGAGAAGG
Get precursor sequence
Structure
        10         20         30         40        50        60  
GCCUGGGCUGGCCAGCU-   -    A    UU        -|  A         UGUGAGUAU 
                  GUG AGUA UUCU  GGCAGUGU CUU GCUGGUUGU         U
                  CAC UCGU AAGA  CCGUCAUA GAA CGACUAACG         A
GGAAGAGCCGGGUUGUUA   G    G    UC        U^  -         AAGGAAUCG 
    120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-34-P1_5p

MirBase accessionMIMAT0000542
Sequence
0- UGGCAGUGUCUUAGCUGGUUGU -22
Get sequence
Validated targets microrna.org: MIMAT0000542
TargetScanVert: mmu-miR-34a-5p
miRDB: MIMAT0000542
Star sequence

Mmu-Mir-34-P1_3p*

MirBase accessionMIMAT0017022
Sequence
44- AAUCAGCAAGUAUACUGCCCUA -66
Get sequence
Validated targets TargetScanVert: mmu-miR-34a-3p
miRDB: MIMAT0017022