MirGeneDB

MirGeneDB ID

Mmu-Mir-34-P2a

Family name MIR-34 (all species)
Seed GGCAGUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-34b
Paralogues Mmu-Mir-34-P1  Mmu-Mir-34-P2b  Mmu-Mir-34-P3a  Mmu-Mir-34-P3b  Mmu-Mir-34-P3c 
Orthologues Aae-Mir-34  Aca-Mir-34-P2a  Ami-Mir-34-P2a  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P2a  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P2a-v1  Cfa-Mir-34-P2a-v2  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P2a  Cpi-Mir-34-P2a  Cpo-Mir-34-P2a  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P2a  Dpu-Mir-34  Dre-Mir-34-P2a  Efe-Mir-34  Ete-Mir-34-P2a  Gga-Mir-34-P2a  Hsa-Mir-34-P2a  Lgi-Mir-34  Mdo-Mir-34-P2a  Mml-Mir-34-P2a  Oan-Mir-34-P2a  Ocu-Mir-34-P2a  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P2a  Sha-Mir-34-P2a  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P2a  Tca-Mir-34  Tgu-Mir-34-P2a5  Tgu-Mir-34-P2a6  Xtr-Mir-34-P2a1  Xtr-Mir-34-P2a2  Xtr-Mir-34-P2a3  Xtr-Mir-34-P2a4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr9: 51103574-51103632 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P2a)
Mir-34-P2b chr9: 51103044-51103098 [-] UCSC Ensembl
Mir-34-P2a chr9: 51103574-51103632 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGUGGCGGGCGCCCGGUGCUCGGUUUGUAGGCAGUGUAAUUAGCUGAUUGUAGUGCGGUGCUGACAAUCACUAACUCCACUGCCAUCAAAACAAGGCACAGCAUCACCCGCCGCCCG
Get precursor sequence
Structure
        10         20        30         40        50         
GCAGUGGCGGGCGCCCG-     CG    GUA-|      UAA    C       AGUGC 
                  GUGCU  GUUU    GGCAGUG   UUAG UGAUUGU     G
                  CACGG  CAAA    CCGUCAC   AAUC ACUAACA     G
GCCCGCCGCCCACUACGA     AA    ACUA^      CUC    -       GUCGU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-34-P2a_5p

MirBase accessionMIMAT0000382
Sequence
0- AGGCAGUGUAAUUAGCUGAUUGU -23
Get sequence
Validated targets microrna.org: MIMAT0000382
TargetScanVert: mmu-miR-34b-5p
miRDB: MIMAT0000382
Star sequence

Mmu-Mir-34-P2a_3p*

MirBase accessionMIMAT0004581
Sequence
37- AAUCACUAACUCCACUGCCAUC -59
Get sequence
Validated targets microrna.org: MIMAT0004581
TargetScanVert: mmu-miR-34b-3p
miRDB: MIMAT0004581