MirGeneDB

MirGeneDB ID

Cli-Mir-34-P2a

Family name MIR-34 (all species)
Seed GGCAGUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-34b
Paralogues Cli-Mir-34-P1  Cli-Mir-34-P2b  Cli-Mir-34-P3a  Cli-Mir-34-P3b  Cli-Mir-34-P3c  Cli-Mir-34-P3d 
Orthologues Aae-Mir-34  Aca-Mir-34-P2a  Ami-Mir-34-P2a  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P2a  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P2a-v1  Cfa-Mir-34-P2a-v2  Cgi-Mir-34  Cin-Mir-34  Cpi-Mir-34-P2a  Cpo-Mir-34-P2a  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P2a  Dpu-Mir-34  Dre-Mir-34-P2a  Efe-Mir-34  Ete-Mir-34-P2a  Gga-Mir-34-P2a  Hsa-Mir-34-P2a  Lgi-Mir-34  Mdo-Mir-34-P2a  Mml-Mir-34-P2a  Mmu-Mir-34-P2a  Oan-Mir-34-P2a  Ocu-Mir-34-P2a  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P2a  Sha-Mir-34-P2a  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P2a  Tca-Mir-34  Tgu-Mir-34-P2a5  Tgu-Mir-34-P2a6  Xtr-Mir-34-P2a1  Xtr-Mir-34-P2a2  Xtr-Mir-34-P2a3  Xtr-Mir-34-P2a4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold77: 2057114-2057172 [+]
Clustered MiRNAs
(< 10kb from Mir-34-P2a)
Mir-34-P2a scaffold77: 2057114-2057172 [+]
Mir-34-P2b scaffold77: 2057489-2057543 [+]
Precursor
(pre-Mir +30nt flank)
ACCCCAUCACAAGAGUGGUGCUUGGUUUGUAGGCAGUGUAGUUAGCUGAUUGUAACCACUGCUCCGCAAUCACUACACUCACUGCCAUCAAAACAAGGCACAGGAUUCCCUGCUGCAAC
Get precursor sequence
Structure
        10         20         30        40         50         
ACCCCAUCACAAGAGUG-      GG-|   UA       U   -   C       AACCA 
                  GUGCUU   UUUG  GGCAGUG AGU UAG UGAUUGU     C
                  CACGGA   AAAC  CCGUCAC UCA AUC ACUAACG     U
CAACGUCGUCCCUUAGGA      ACA^   UA       -   C   -       CCUCG 
       110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-34-P2a_5p

MirBase accessionMIMAT0038469
Sequence
0- AGGCAGUGUAGUUAGCUGAUUGU -23
Get sequence
Star sequence

Cli-Mir-34-P2a_3p*

MirBase accessionMIMAT0038470
Sequence
37- AAUCACUACACUCACUGCCAUC -59
Get sequence