MirGeneDB

MirGeneDB ID

Aca-Mir-34-P2a

Family name MIR-34 (all species)
Seed GGCAGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-34c
Paralogues Aca-Mir-34-P1  Aca-Mir-34-P2b  Aca-Mir-34-P3a  Aca-Mir-34-P3c  Aca-Mir-34-P3d 
Orthologues Aae-Mir-34  Ami-Mir-34-P2a  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P2a  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P2a-v1  Cfa-Mir-34-P2a-v2  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P2a  Cpi-Mir-34-P2a  Cpo-Mir-34-P2a  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P2a  Dpu-Mir-34  Dre-Mir-34-P2a  Efe-Mir-34  Ete-Mir-34-P2a  Gga-Mir-34-P2a  Hsa-Mir-34-P2a  Lgi-Mir-34  Mdo-Mir-34-P2a  Mml-Mir-34-P2a  Mmu-Mir-34-P2a  Oan-Mir-34-P2a  Ocu-Mir-34-P2a  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P2a  Sha-Mir-34-P2a  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P2a  Tca-Mir-34  Tgu-Mir-34-P2a5  Tgu-Mir-34-P2a6  Xtr-Mir-34-P2a1  Xtr-Mir-34-P2a2  Xtr-Mir-34-P2a3  Xtr-Mir-34-P2a4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343521.1: 197485-197543 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P2a)
Mir-34-P2b GL343521.1: 196053-196106 [-] UCSC Ensembl
Mir-34-P2a GL343521.1: 197485-197543 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGUCUACGUCUGUUGGAACGCUUGGUUUGUAGGCAGUGUAGUUAGCUGAUUGUGAGGUUUCCUUGGCAAUCACUAGCUUUACUGUCAUCAAAACAAGGCGUGGGAUUCCCACUCUGCGA
Get precursor sequence
Structure
        10         20         30        40        50         
GGUCUACGUCUGUUGGA-      GG-|   UA       U      C       GAGGU 
                  ACGCUU   UUUG  GGCAGUG AGUUAG UGAUUGU     U
                  UGCGGA   AAAC  CUGUCAU UCGAUC ACUAACG     U
AGCGUCUCACCCUUAGGG      ACA^   UA       U      -       GUUCC 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-34-P2a_5p

MirBase accessionMIMAT0021943
Sequence
0- AGGCAGUGUAGUUAGCUGAUUGU -23
Get sequence
Co-mature sequence

Aca-Mir-34-P2a_3p

MirBase accessionMIMAT0021944
Sequence
37- AAUCACUAGCUUUACUGUCAUC -59
Get sequence