MirGeneDB

MirGeneDB ID

Aca-Mir-34-P3d

Family name MIR-34 (all species)
Seed GGCAGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-449c
Paralogues Aca-Mir-34-P1  Aca-Mir-34-P2a  Aca-Mir-34-P2b  Aca-Mir-34-P3a  Aca-Mir-34-P3c 
Orthologues Aae-Mir-34  Ami-Mir-34-P3d  Asu-Mir-34  Bge-Mir-34  Cbr-Mir-34  Cel-Mir-34  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3d  Cpi-Mir-34-P3d  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dpu-Mir-34  Efe-Mir-34  Gga-Mir-34-P3d  Lgi-Mir-34  Mdo-Mir-34-P3d  Pfl-Mir-34  Pmi-Mir-34  Sha-Mir-34-P3d  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P3d  Tca-Mir-34  Tgu-Mir-34-P3d 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
2: 2666240-2666298 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P3d)
Mir-34-P3c 2: 2663692-2663757 [+] UCSC Ensembl
Mir-34-P3a 2: 2665578-2665639 [+] UCSC Ensembl
Mir-34-P3d 2: 2666240-2666298 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGUAUCAGUAUUCUCUGUAUGUGAUGGUUUGGCAGUGUACUCUUAGUUAGCUGUUGUAUAUAUUACAGCAACUAAAUACACUUCCAUAUUAUUGCAUGACUUUGCACCACUGCUUAAU
Get precursor sequence
Structure
        10          20        30        40        50        60
UGGUAUCAGUAUUCUCUG--|   UG     U   C      CUC      A    UUGUA 
                    UAUG  AUGGU UGG AGUGUA   UUAGUU GCUG     U
                    GUAC  UAUUA ACC UCACAU   AAUCAA CGAC     A
UAAUUCGUCACCACGUUUCA^   GU     U   U      A--      -    AUUAU 
       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-34-P3d_5p

MirBase accessionMIMAT0022014
Sequence
0- UGGCAGUGUACUCUUAGUUAGCUG -24
Get sequence
Star sequence

Aca-Mir-34-P3d_3p*

MirBase accessionMIMAT0022015
Sequence
38- GCAACUAAAUACACUUCCAUA -59
Get sequence