MirGeneDB

MirGeneDB ID

Aca-Mir-34-P2b

Family name MIR-34 (all species)
Seed GGCAGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-34a
Paralogues Aca-Mir-34-P1  Aca-Mir-34-P2a  Aca-Mir-34-P3a  Aca-Mir-34-P3c  Aca-Mir-34-P3d 
Orthologues Aae-Mir-34  Ami-Mir-34-P2b  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P2b  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P2b  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P2b  Cpi-Mir-34-P2b  Cpo-Mir-34-P2b  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P2b  Dpu-Mir-34  Dre-Mir-34-P2b  Efe-Mir-34  Ete-Mir-34-P2b  Gga-Mir-34-P2b  Hsa-Mir-34-P2b  Lgi-Mir-34  Mdo-Mir-34-P2b  Mml-Mir-34-P2b  Mmu-Mir-34-P2b  Oan-Mir-34-P2b  Ocu-Mir-34-P2b  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P2b  Sha-Mir-34-P2b  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P2b  Tca-Mir-34  Tgu-Mir-34-P2b  Xtr-Mir-34-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343521.1: 196053-196106 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P2b)
Mir-34-P2b GL343521.1: 196053-196106 [-] UCSC Ensembl
Mir-34-P2a GL343521.1: 197485-197543 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACAAAGGGAUCCCGAUGGGCCUGGUUGCCAGGCAGUGUAGUUAGCUGAUUGACGAGGCAACAGUCACUAACAACACGGCCAGGUGAAACGGCCUACCUCCCACCUGUUUGGAU
Get precursor sequence
Structure
        10          20        30        40        50       
AACAAAGGGAUCCCGAU--|    UGG UG  A   A    A     C      ACGA 
                   GGGCC   U  CC GGC GUGU GUUAG UGAUUG    \
                   UCCGG   A  GG CCG CACA CAAUC ACUGAC    G
UAGGUUUGUCCACCCUCCA^    CAA GU  A   G    A     -      AACG 
  110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-34-P2b_5p

MirBase accessionMIMAT0021939
Sequence
0- AGGCAGUGUAGUUAGCUGAUUGA -23
Get sequence
Star sequence

Aca-Mir-34-P2b_3p*

MirBase accessionMIMAT0021940
Sequence
32- AGUCACUAACAACACGGCCAGG -54
Get sequence