MirGeneDB

MirGeneDB ID

Aca-Mir-34-P3a

Family name MIR-34 (all species)
Seed GGCAGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-449a
Paralogues Aca-Mir-34-P1  Aca-Mir-34-P2a  Aca-Mir-34-P2b  Aca-Mir-34-P3c  Aca-Mir-34-P3d 
Orthologues Aae-Mir-34  Ami-Mir-34-P3a  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P3a  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P3a  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3a  Cpi-Mir-34-P3a  Cpo-Mir-34-P3a  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P3a  Dpu-Mir-34  Efe-Mir-34  Ete-Mir-34-P3a  Gga-Mir-34-P3a  Hsa-Mir-34-P3a  Lgi-Mir-34  Mdo-Mir-34-P3a  Mml-Mir-34-P3a  Mmu-Mir-34-P3a  Oan-Mir-34-P3a  Ocu-Mir-34-P3a  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P3a  Sha-Mir-34-P3a  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P3a  Tca-Mir-34  Tgu-Mir-34-P3a  Xtr-Mir-34-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
2: 2665578-2665639 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P3a)
Mir-34-P3c 2: 2663692-2663757 [+] UCSC Ensembl
Mir-34-P3a 2: 2665578-2665639 [+] UCSC Ensembl
Mir-34-P3d 2: 2666240-2666298 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUGUGUGUGUGUGUGUGUGUGUGGUGGAAUGGCAGUGUAUUGUUAGCUGGAUGAGUAUCUCAAUGCCCCCAGCUGACAUUCAGCUGCCAAUCUACGGCACAUAUUUGGAUCAUCAAACCAC
Get precursor sequence
Structure
        10          20        30        40        50        60
UCUGUGUGUGUGUGUGU--|     G     A       GUAU          AUGAGUAU 
                   GUGUGU GUGGA UGGCAGU    UGUUAGCUGG        C
                   UACACG CAUCU ACCGUCG    ACAGUCGACC        U
CACCAAACUACUAGGUUUA^     G     A       ACUU          CCCGUAAC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-34-P3a_5p

MirBase accessionMIMAT0021958
Sequence
0- UGGCAGUGUAUUGUUAGCUGGA -22
Get sequence
Star sequence

Aca-Mir-34-P3a_3p* (predicted)

MirBase accessionNone
Sequence
40- CAGCUGACAUUCAGCUGCCAAU -62
Get sequence