MirGeneDB

MirGeneDB ID

Aca-Mir-34-P1

Family name MIR-34 (all species)
Seed GGCAGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-34b
Paralogues Aca-Mir-34-P2a  Aca-Mir-34-P2b  Aca-Mir-34-P3a  Aca-Mir-34-P3c  Aca-Mir-34-P3d 
Orthologues Aae-Mir-34  Ami-Mir-34-P1  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P1  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P1  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P1  Cpi-Mir-34-P1  Cpo-Mir-34-P1  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P1  Dpu-Mir-34  Dre-Mir-34-P1  Efe-Mir-34  Ete-Mir-34-P1  Gga-Mir-34-P1  Hsa-Mir-34-P1  Lgi-Mir-34  Mdo-Mir-34-P1  Mml-Mir-34-P1  Mmu-Mir-34-P1  Oan-Mir-34-P1  Ocu-Mir-34-P1  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P1  Sha-Mir-34-P1  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P1  Tca-Mir-34  Tgu-Mir-34-P1  Xtr-Mir-34-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343701.1: 93370-93435 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAGAAGGGCCGCCGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGCGCAGUGAUUGAGGAAGCAAUCAGCAAGAAUACUGCCCCAGAAGUGCUGCACGCAACCUUCGGAUCCGGA
Get precursor sequence
Structure
        10         20         30         40        50        60  
AAAGAAGGGCCGCCGCU-   -  UG     UU       -|   A         UGUGCGCAG 
                  GUG AG  UUUCU  GGCAGUG UCUU GCUGGUUGU         U
                  CAC UC  GAAGA  CCGUCAU AGAA CGACUAACG         G
AGGCCUAGGCUUCCAACG   G  GU     CC       A^   -         AAGGAGUUA 
    120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-34-P1_5p

MirBase accessionMIMAT0021941
Sequence
0- UGGCAGUGUCUUAGCUGGUUGU -22
Get sequence
Star sequence

Aca-Mir-34-P1_3p*

MirBase accessionMIMAT0021942
Sequence
44- AAUCAGCAAGAAUACUGCCCCA -66
Get sequence