MirGeneDB

MirGeneDB ID

Sto-Mir-34-P2b

Family name MIR-34 (all species)
Seed GGCAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-34-P1  Sto-Mir-34-P2a  Sto-Mir-34-P3a  Sto-Mir-34-P3c  Sto-Mir-34-P3d 
Orthologues Aae-Mir-34  Aca-Mir-34-P2b  Ami-Mir-34-P2b  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P2b  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P2b  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P2b  Cpi-Mir-34-P2b  Cpo-Mir-34-P2b  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P2b  Dpu-Mir-34  Dre-Mir-34-P2b  Efe-Mir-34  Ete-Mir-34-P2b  Gga-Mir-34-P2b  Hsa-Mir-34-P2b  Lgi-Mir-34  Mdo-Mir-34-P2b  Mml-Mir-34-P2b  Mmu-Mir-34-P2b  Oan-Mir-34-P2b  Ocu-Mir-34-P2b  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P2b  Sha-Mir-34-P2b  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Tgu-Mir-34-P2b  Xtr-Mir-34-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01039167.1: 480-540 [-]
Precursor
(pre-Mir +30nt flank)
UCCAUUGUAUUUGGUAACCGCCUGGUUGCUAGGCAGUGUAGUUAGCUGAUUGGUAAACUCUAACUAAGCAAUCACUAACCACACAGCCAGGCAAACUGGUCAGGAUCACAUCCUGAACUGG
Get precursor sequence
Structure
        10          20        30        40        50        60
UCCAUUGUAUUUGGUAACC--|  UGG     A   A    A     C      GUAAACU 
                     GCC   UUGCU GGC GUGU GUUAG UGAUUG       C
                     UGG   AACGG CCG CACA CAAUC ACUAAC       U
GGUCAAGUCCUACACUAGGAC^  UCA     A   A    C     -      GAAUCAA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-34-P2b_5p

MirBase accessionNone
Sequence
0- AGGCAGUGUAGUUAGCUGAUUGG -23
Get sequence
Star sequence

Sto-Mir-34-P2b_3p*

MirBase accessionNone
Sequence
39- AAUCACUAACCACACAGCCAGG -61
Get sequence