
MirGeneDB ID


Family name MIR-34 (all species)
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-34c
Paralogues Rno-Mir-34-P1  Rno-Mir-34-P2a  Rno-Mir-34-P3a  Rno-Mir-34-P3b  Rno-Mir-34-P3c 
Orthologues Aae-Mir-34  Aca-Mir-34-P2b  Ami-Mir-34-P2b  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P2b  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P2b  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P2b  Cpi-Mir-34-P2b  Cpo-Mir-34-P2b  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P2b  Dpu-Mir-34  Dre-Mir-34-P2b  Efe-Mir-34  Ete-Mir-34-P2b  Gga-Mir-34-P2b  Hsa-Mir-34-P2b  Lgi-Mir-34  Mdo-Mir-34-P2b  Mml-Mir-34-P2b  Mmu-Mir-34-P2b  Oan-Mir-34-P2b  Ocu-Mir-34-P2b  Pfl-Mir-34  Pmi-Mir-34  Sha-Mir-34-P2b  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P2b  Tca-Mir-34  Tgu-Mir-34-P2b  Xtr-Mir-34-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
chr8: 55492034-55492088 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P2b)
Mir-34-P2b chr8: 55492034-55492088 [-] UCSC Ensembl
Mir-34-P2a chr8: 55492554-55492612 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40        50       
UGCAGGCUUUUUUCUAUG--|    AG     A   A    A     C      CUAA 
                    AGUCU  UUACU GGC GUGU GUUAG UGAUUG    U
                    UCAGA  AAUGG CCG CACA CAAUC ACUAAC    A
CCGAGACAGCCUCCUUAAAG^    AA     A   A    C     -      CAUG 
   110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence


MirBase accessionMIMAT0000814
Get sequence
Validated targets microrna.org: MIMAT0000814
TargetScanVert: rno-miR-34c-5p
miRDB: MIMAT0000814
Star sequence


MirBase accessionMIMAT0004723
Get sequence
Validated targets microrna.org: MIMAT0004723
TargetScanVert: rno-miR-34c-3p
miRDB: MIMAT0004723