MirGeneDB

MirGeneDB ID

Cli-Mir-34-P2b

Family name MIR-34 (all species)
Seed GGCAGUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-34c
Paralogues Cli-Mir-34-P1  Cli-Mir-34-P2a  Cli-Mir-34-P3a  Cli-Mir-34-P3b  Cli-Mir-34-P3c  Cli-Mir-34-P3d 
Orthologues Aae-Mir-34  Aca-Mir-34-P2b  Ami-Mir-34-P2b  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P2b  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P2b  Cgi-Mir-34  Cin-Mir-34  Cpi-Mir-34-P2b  Cpo-Mir-34-P2b  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P2b  Dpu-Mir-34  Dre-Mir-34-P2b  Efe-Mir-34  Ete-Mir-34-P2b  Gga-Mir-34-P2b  Hsa-Mir-34-P2b  Lgi-Mir-34  Mdo-Mir-34-P2b  Mml-Mir-34-P2b  Mmu-Mir-34-P2b  Oan-Mir-34-P2b  Ocu-Mir-34-P2b  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P2b  Sha-Mir-34-P2b  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P2b  Tca-Mir-34  Tgu-Mir-34-P2b  Xtr-Mir-34-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold77: 2057489-2057543 [+]
Clustered MiRNAs
(< 10kb from Mir-34-P2b)
Mir-34-P2a scaffold77: 2057114-2057172 [+]
Mir-34-P2b scaffold77: 2057489-2057543 [+]
Precursor
(pre-Mir +30nt flank)
AAAGGGAACUCUCACAUCAGCCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCCAAAAGUACCAAUCACUAGCCACACAGCCAGGUAAAAAGGCUUGGAAGAUAUCUCAAUGGAG
Get precursor sequence
Structure
        10          20        30        40        50       
AAAGGGAACUCUCACAUC--|    AG     A   A    A     C      CCAA 
                    AGCCU  UUACU GGC GUGU GUUAG UGAUUG    A
                    UCGGA  AAUGG CCG CACA CGAUC ACUAAC    A
GAGGUAACUCUAUAGAAGGU^    AA     A   A    C     -      CAUG 
   110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-34-P2b_5p

MirBase accessionMIMAT0038471
Sequence
0- AGGCAGUGUAGUUAGCUGAUUGC -23
Get sequence
Star sequence

Cli-Mir-34-P2b_3p*

MirBase accessionMIMAT0038472
Sequence
33- AAUCACUAGCCACACAGCCAGG -55
Get sequence