MirGeneDB

MirGeneDB ID

Rno-Mir-15-P1a

Family name MIR-15 (all species)
Seed AGCAGCA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-15a
Paralogues Rno-Mir-15-P1b  Rno-Mir-15-P1c  Rno-Mir-15-P1d1  Rno-Mir-15-P1d2  Rno-Mir-15-P2a  Rno-Mir-15-P2b  Rno-Mir-15-P2c  Rno-Mir-15-P2d1  Rno-Mir-15-P2d2 
Orthologues Ami-Mir-15-P1a  Bta-Mir-15-P1a  Cfa-Mir-15-P1a  Cin-Mir-15-P1  Cli-Mir-15-P1a  Cpi-Mir-15-P1a  Cpo-Mir-15-P1a  Dno-Mir-15-P1a  Dre-Mir-15-P1a1  Dre-Mir-15-P1a2  Ete-Mir-15-P1a  Gga-Mir-15-P1a  Hsa-Mir-15-P1a  Mdo-Mir-15-P1a  Mml-Mir-15-P1a  Mmu-Mir-15-P1a  Oan-Mir-15-P1a  Ocu-Mir-15-P1a  Sha-Mir-15-P1a  Sto-Mir-15-P1a  Tgu-Mir-15-P1a  Xtr-Mir-15-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(rn6)
901866519: 202-260 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUUUUCAAAAACAAAACCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAUACAAGGAUCUGAUCUUCUGAAGAAAG
Get precursor sequence
Structure
        10           20        30        40        50         
AGUUUUCAAAAACAAAA---|    GAGUAAAGUA        UA         GGAUUUU 
                    CCUUG          GCAGCACA  AUGGUUUGU       \
                    GGAAC          CGUCGUGU  UACCGGACG       G
GAAAGAAGUCUUCUAGUCUA^    AUAAAACUC-        UA         UGGAAAA 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-15-P1a_5p

MirBase accessionMIMAT0035728
Sequence
0- UAGCAGCACAUAAUGGUUUGUG -22
Get sequence
Validated targets TargetScanVert: rno-miR-15a-5p
miRDB: MIMAT0035728
Star sequence

Rno-Mir-15-P1a_3p*

MirBase accessionMIMAT0035729
Sequence
37- CAGGCCAUAUUGUGCUGCCUCA -59
Get sequence
Validated targets TargetScanVert: rno-miR-15a-3p
miRDB: MIMAT0035729