MirGeneDB

MirGeneDB ID

Sto-Mir-15-P1a

Family name MIR-15 (all species)
Seed AGCAGCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-15-P1b  Sto-Mir-15-P1c  Sto-Mir-15-P2a  Sto-Mir-15-P2b  Sto-Mir-15-P2c 
Orthologues Ami-Mir-15-P1a  Bta-Mir-15-P1a  Cfa-Mir-15-P1a  Cin-Mir-15-P1  Cli-Mir-15-P1a  Cpi-Mir-15-P1a  Cpo-Mir-15-P1a  Dno-Mir-15-P1a  Dre-Mir-15-P1a1  Dre-Mir-15-P1a2  Ete-Mir-15-P1a  Gga-Mir-15-P1a  Hsa-Mir-15-P1a  Mdo-Mir-15-P1a  Mml-Mir-15-P1a  Mmu-Mir-15-P1a  Oan-Mir-15-P1a  Ocu-Mir-15-P1a  Rno-Mir-15-P1a  Sha-Mir-15-P1a  Tgu-Mir-15-P1a  Xtr-Mir-15-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(miRNA_loci_genome)
BFAA01008186.1: 126152-126210 [+]
Precursor
(pre-Mir +30nt flank)
AAAAUCCAAUGUGGAGAUCCUGUGGUGAACUAGCAGCACAUAAUGGUUUGUGAGUUGUACGGAGAUGCAGGCCACAUUGUGCUGCCACAUGAACACAGGAGUAUAAUCUGAUUUCACUA
Get precursor sequence
Structure
        10          20        30        40        50         
AAAAUCCAAUGUGGAGA--|      GUGAACUA        UAA        GAGUUGU 
                   UCCUGUG        GCAGCACA   UGGUUUGU       \
                   AGGACAC        CGUCGUGU   ACCGGACG       A
AUCACUUUAGUCUAAUAUG^      AAGUACAC        UAC        UAGAGGC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-15-P1a_5p

MirBase accessionNone
Sequence
0- UAGCAGCACAUAAUGGUUUGUG -22
Get sequence
Star sequence

Sto-Mir-15-P1a_3p*

MirBase accessionNone
Sequence
37- CAGGCCACAUUGUGCUGCCACA -59
Get sequence