MirGeneDB

MirGeneDB ID

Sto-Mir-15-P2b

Family name MIR-15 (all species)
Seed AGCAGCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-15-P1a  Sto-Mir-15-P1b  Sto-Mir-15-P1c  Sto-Mir-15-P2a  Sto-Mir-15-P2c 
Orthologues Aca-Mir-15-P2b  Ami-Mir-15-P2b  Bta-Mir-15-P2b  Cfa-Mir-15-P2b  Cin-Mir-15-P2  Cli-Mir-15-P2b  Cpo-Mir-15-P2b  Dno-Mir-15-P2b  Dre-Mir-15-P2b  Ete-Mir-15-P2b  Gga-Mir-15-P2b  Hsa-Mir-15-P2b  Mdo-Mir-15-P2b  Mml-Mir-15-P2b  Mmu-Mir-15-P2b  Oan-Mir-15-P2b  Ocu-Mir-15-P2b  Rno-Mir-15-P2b  Sha-Mir-15-P2b  Tgu-Mir-15-P2b  Xtr-Mir-15-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(miRNA_loci_genome)
BFAA01000434.1: 79754-79810 [-]
Precursor
(pre-Mir +30nt flank)
GACCUGUUAAUGAAAAUGCCAGUUACACUUUAGCAGCACGUAAAUAUUGGCGUGGCAAUAAUCGCCAAUAUUACUUGUGCUGCUGCAGCGUGACAUGGUUUUAUCACCCGCCAGAUC
Get precursor sequence
Structure
        10         20         30        40         50       
GACCUGUUAAUGAAAAU-    -     A  U          UA-|         UGGC 
                  GCCA GUUAC CU UAGCAGCACG   AAUAUUGGCG    A
                  UGGU CAGUG GA GUCGUCGUGU   UUAUAACCGC    A
CUAGACCGCCCACUAUUU    A     C  C          UCA^         UAAU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-15-P2b_5p

MirBase accessionNone
Sequence
0- UAGCAGCACGUAAAUAUUGGCG -22
Get sequence
Star sequence

Sto-Mir-15-P2b_3p*

MirBase accessionNone
Sequence
34- CCAAUAUUACUUGUGCUGCUGCA -57
Get sequence