MirGeneDB

MirGeneDB ID

Aca-Mir-15-P2b

Family name MIR-15 (all species)
Seed AGCAGCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-16a
Paralogues Aca-Mir-15-P1b  Aca-Mir-15-P1d  Aca-Mir-15-P2c  Aca-Mir-15-P2d 
Orthologues Ami-Mir-15-P2b  Bta-Mir-15-P2b  Cfa-Mir-15-P2b  Cin-Mir-15-P2  Cli-Mir-15-P2b  Cpo-Mir-15-P2b  Dno-Mir-15-P2b  Dre-Mir-15-P2b  Ete-Mir-15-P2b  Gga-Mir-15-P2b  Hsa-Mir-15-P2b  Mdo-Mir-15-P2b  Mml-Mir-15-P2b  Mmu-Mir-15-P2b  Oan-Mir-15-P2b  Ocu-Mir-15-P2b  Rno-Mir-15-P2b  Sha-Mir-15-P2b  Sto-Mir-15-P2b  Tgu-Mir-15-P2b  Xtr-Mir-15-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(anoCar2)
3: 13038975-13039038 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P2b)
Mir-15-P2b 3: 13038975-13039038 [-] UCSC Ensembl
Mir-15-P1b 3: 13039125-13039184 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUAAAACAAUUGUUAUACUUGUUCCGCCCUAGCAGCACGUAAAUAUUGGUGUAGUAAAGAUAAUCUUAACCCCAAUAUUGUUGUGCUGCUUAAGCGUGGCAGGGAUUAAGCAACAAUGUUGUU
Get precursor sequence
Structure
        10          20        30        40        50        60 
AAUAAAACAAUUGUUAUA--|    UC   CCU         UA        U  AGUAAAG 
                    CUUGU  CGC   AGCAGCACG  AAUAUUGG GU       A
                    GGACG  GCG   UCGUCGUGU  UUAUAACC CA       U
UUGUUGUAACAACGAAUUAG^    GU   AAU         UG        C  AUUCUAA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-15-P2b_5p

MirBase accessionMIMAT0021799
Sequence
0- UAGCAGCACGUAAAUAUUGGUGU -23
Get sequence
Star sequence

Aca-Mir-15-P2b_3p*

MirBase accessionMIMAT0021800
Sequence
41- CCCAAUAUUGUUGUGCUGCUUAA -64
Get sequence