MirGeneDB

MirGeneDB ID

Cli-Mir-15-P2b

Family name MIR-15 (all species)
Seed AGCAGCA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-16a-2
Paralogues Cli-Mir-15-P1a  Cli-Mir-15-P1b  Cli-Mir-15-P1d  Cli-Mir-15-P2a  Cli-Mir-15-P2d 
Orthologues Aca-Mir-15-P2b  Ami-Mir-15-P2b  Bta-Mir-15-P2b  Cfa-Mir-15-P2b  Cin-Mir-15-P2  Cpo-Mir-15-P2b  Dno-Mir-15-P2b  Dre-Mir-15-P2b  Ete-Mir-15-P2b  Gga-Mir-15-P2b  Hsa-Mir-15-P2b  Mdo-Mir-15-P2b  Mml-Mir-15-P2b  Mmu-Mir-15-P2b  Oan-Mir-15-P2b  Ocu-Mir-15-P2b  Rno-Mir-15-P2b  Sha-Mir-15-P2b  Sto-Mir-15-P2b  Tgu-Mir-15-P2b  Xtr-Mir-15-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(colLiv2)
scaffold258: 1615804-1615868 [+]
Clustered MiRNAs
(< 10kb from Mir-15-P2b)
Mir-15-P1b scaffold258: 1615632-1615691 [+]
Mir-15-P2b scaffold258: 1615804-1615868 [+]
Precursor
(pre-Mir +30nt flank)
AAUAGAAGAGUUGUCAUACUUGUUCCGCCCUAGCAGCACGUAAAUAUUGGUGUAGUAAAAUAAACCUUAAACCCCAAUAUUAUUGUGCUGCUUAAGCGUGGCAGAGAUUCAGCAACUCCUUUAUG
Get precursor sequence
Structure
        10          20        30        40        50        60  
AAUAGAAGAGUUGUCAUAC--|   UC   CCU         UA        U  AGUAAAAU 
                     UUGU  CGC   AGCAGCACG  AAUAUUGG GU        \
                     GACG  GCG   UCGUCGUGU  UUAUAACC CA        A
GUAUUUCCUCAACGACUUAGA^   GU   AAU         UA        C  AAUUCCAA 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-15-P2b_5p

MirBase accessionMIMAT0038416
Sequence
0- UAGCAGCACGUAAAUAUUGGUGU -23
Get sequence
Star sequence

Cli-Mir-15-P2b_3p*

MirBase accessionMIMAT0038418
Sequence
42- CCCAAUAUUAUUGUGCUGCUUAA -65
Get sequence