MirGeneDB

MirGeneDB ID

Cli-Mir-15-P1b

Family name MIR-15 (all species)
Seed AGCAGCA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-15b
Paralogues Cli-Mir-15-P1a  Cli-Mir-15-P1d  Cli-Mir-15-P2a  Cli-Mir-15-P2b  Cli-Mir-15-P2d 
Orthologues Aca-Mir-15-P1b  Ami-Mir-15-P1b  Bta-Mir-15-P1b  Cfa-Mir-15-P1b  Cin-Mir-15-P1  Cpo-Mir-15-P1b  Dno-Mir-15-P1b  Dre-Mir-15-P1b  Ete-Mir-15-P1b  Gga-Mir-15-P1b  Hsa-Mir-15-P1b  Mml-Mir-15-P1b  Mmu-Mir-15-P1b  Oan-Mir-15-P1b  Ocu-Mir-15-P1b  Rno-Mir-15-P1b  Sha-Mir-15-P1b  Sto-Mir-15-P1b  Tgu-Mir-15-P1b  Xtr-Mir-15-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(colLiv2)
scaffold258: 1615632-1615691 [+]
Clustered MiRNAs
(< 10kb from Mir-15-P1b)
Mir-15-P1b scaffold258: 1615632-1615691 [+]
Mir-15-P2b scaffold258: 1615804-1615868 [+]
Precursor
(pre-Mir +30nt flank)
AAGUCUUGUAUUUGAGGCCUUAAAGUACUCUAGCAGCACAUCAUGGUUUGCAUGCUCUAAUAAAGAUGCGAAUCAUUAUUUGCUGCUUUAGAAAUUUAAGGAAGAGAAACAGUUGAAGAU
Get precursor sequence
Structure
        10          20        30        40        50         
AAGUCUUGUAUUUGAGG--|      GUA  CU       C  C          UGCUCU 
                   CCUUAAA   CU  AGCAGCA AU AUGGUUUGCA      A
                   GGAAUUU   GA  UCGUCGU UA UACUAAGCGU      A
UAGAAGUUGACAAAGAGAA^      AAA  UU       U  U          AGAAAU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-15-P1b_5p

MirBase accessionMIMAT0038412
Sequence
0- UAGCAGCACAUCAUGGUUUGCA -22
Get sequence
Star sequence

Cli-Mir-15-P1b_3p*

MirBase accessionMIMAT0038413
Sequence
38- CGAAUCAUUAUUUGCUGCUUUA -60
Get sequence