MirGeneDB

MirGeneDB ID

Bta-Mir-15-P1b

Family name MIR-15 (all species)
Seed AGCAGCA
Species Cow (Bos taurus)
MiRBase ID bta-mir-15b
Paralogues Bta-Mir-15-P1a  Bta-Mir-15-P1c  Bta-Mir-15-P1d  Bta-Mir-15-P2a  Bta-Mir-15-P2b  Bta-Mir-15-P2c  Bta-Mir-15-P2d 
Orthologues Aca-Mir-15-P1b  Ami-Mir-15-P1b  Cfa-Mir-15-P1b  Cin-Mir-15-P1  Cli-Mir-15-P1b  Cpo-Mir-15-P1b  Dno-Mir-15-P1b  Dre-Mir-15-P1b  Ete-Mir-15-P1b  Gga-Mir-15-P1b  Hsa-Mir-15-P1b  Mml-Mir-15-P1b  Mmu-Mir-15-P1b  Oan-Mir-15-P1b  Ocu-Mir-15-P1b  Rno-Mir-15-P1b  Sha-Mir-15-P1b  Sto-Mir-15-P1b  Tgu-Mir-15-P1b  Xtr-Mir-15-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(bosTau8)
chr1: 107923398-107923457 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P1b)
Mir-15-P2b chr1: 107923248-107923312 [-] UCSC Ensembl
Mir-15-P1b chr1: 107923398-107923457 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUCCUGUAUUUUUGAGACCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUACUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAUUCAGAACUGUA
Get precursor sequence
Structure
        10          20        30        40        50         
AUCCUGUAUUUUUGAGA--|      GUA   U       C  C      UA  UACUAC 
                   CCUUAAA   CUG AGCAGCA AU AUGGUU  CA      A
                   GGAAUUU   GAU UCGUCGU UA UACUAA  GU      G
AUGUCAAGACUUACUUAAA^      AAA   C       U  U      GC  AGAACU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-15-P1b_5p

MirBase accessionMIMAT0003792
Sequence
0- UAGCAGCACAUCAUGGUUUACA -22
Get sequence
Validated targets TargetScanVert: bta-miR-15b
Star sequence

Bta-Mir-15-P1b_3p*

MirBase accessionNone
Sequence
38- CGAAUCAUUAUUUGCUGCUCUA -60
Get sequence