MirGeneDB

MirGeneDB ID

Bta-Mir-15-P2d

Family name MIR-15 (all species)
Seed AGCAGCG
Species Cow (Bos taurus)
MiRBase ID bta-mir-503
Paralogues Bta-Mir-15-P1a  Bta-Mir-15-P1b  Bta-Mir-15-P1c  Bta-Mir-15-P1d  Bta-Mir-15-P2a  Bta-Mir-15-P2b  Bta-Mir-15-P2c 
Orthologues Aca-Mir-15-P2d  Ami-Mir-15-P2d  Cfa-Mir-15-P2d  Cin-Mir-15-P2  Cli-Mir-15-P2d  Cpo-Mir-15-P2d  Dno-Mir-15-P2d  Dre-Mir-15-P2d  Ete-Mir-15-P2d  Gga-Mir-15-P2d  Hsa-Mir-15-P2d  Mdo-Mir-15-P2d-v1  Mdo-Mir-15-P2d-v2  Mml-Mir-15-P2d  Mmu-Mir-15-P2d  Oan-Mir-15-P2d  Ocu-Mir-15-P2d  Rno-Mir-15-P2d1  Rno-Mir-15-P2d2  Sha-Mir-15-P2d-v1  Sha-Mir-15-P2d-v2  Tgu-Mir-15-P2d  Xtr-Mir-15-P2d 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(bosTau8)
chrX: 18185105-18185167 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P2d)
Mir-450-P3 chrX: 18178920-18178977 [-] UCSC Ensembl
Mir-450-P1 chrX: 18179090-18179146 [-] UCSC Ensembl
Mir-450-P2 chrX: 18179235-18179291 [-] UCSC Ensembl
Mir-542 chrX: 18180151-18180209 [-] UCSC Ensembl
Mir-15-P2d chrX: 18185105-18185167 [-] UCSC Ensembl
Mir-15-P1d chrX: 18185456-18185514 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGGUUGCCGUGCAGCACUCAGCCGUGCCCUAGCAGCGGGAACAGUACUGCAGUGGGCAAUUGGUGAUCUGGAGUAUUGUUUCUGCUGCCCGGGCAAGACUGGGACUCCCGCACGGGCCCCCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGGUUGCCGUGCAGCA--|    CCG     UA                 G   UGGGCAA 
                   CUCAG   UGCCC  GCAGCGGGAACAGUACU CAG       \
                   GGGUC   ACGGG  CGUCGUCUUUGUUAUGA GUC       U
CCCCCCGGGCACGCCCUCA^    AGA     CC                 G   UAGUGGU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-15-P2d_5p

MirBase accessionMIMAT0025557
Sequence
0- UAGCAGCGGGAACAGUACUGCAG -23
Get sequence
Validated targets TargetScanVert: bta-miR-503-5p
Star sequence

Bta-Mir-15-P2d_3p*

MirBase accessionMIMAT0025558
Sequence
40- GGAGUAUUGUUUCUGCUGCCCGG -63
Get sequence
Validated targets TargetScanVert: bta-miR-503-3p