MirGeneDB

MirGeneDB ID

Cli-Mir-15-P1a

Family name MIR-15 (all species)
Seed AGCAGCA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-15a
Paralogues Cli-Mir-15-P1b  Cli-Mir-15-P1d  Cli-Mir-15-P2a  Cli-Mir-15-P2b  Cli-Mir-15-P2d 
Orthologues Ami-Mir-15-P1a  Bta-Mir-15-P1a  Cfa-Mir-15-P1a  Cin-Mir-15-P1  Cpi-Mir-15-P1a  Cpo-Mir-15-P1a  Dno-Mir-15-P1a  Dre-Mir-15-P1a1  Dre-Mir-15-P1a2  Ete-Mir-15-P1a  Gga-Mir-15-P1a  Hsa-Mir-15-P1a  Mdo-Mir-15-P1a  Mml-Mir-15-P1a  Mmu-Mir-15-P1a  Oan-Mir-15-P1a  Ocu-Mir-15-P1a  Rno-Mir-15-P1a  Sha-Mir-15-P1a  Sto-Mir-15-P1a  Tgu-Mir-15-P1a  Xtr-Mir-15-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(colLiv2)
scaffold17: 15185606-15185664 [-]
Clustered MiRNAs
(< 10kb from Mir-15-P1a)
Mir-15-P2a scaffold17: 15185461-15185523 [-]
Mir-15-P1a scaffold17: 15185606-15185664 [-]
Precursor
(pre-Mir +30nt flank)
UUGAAGUAUGGUAGACACCUUGGCAUAACGUAGCAGCACAUAAUGGUUUGUGGGUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGGAUUUCAUCGUCCUGAAGAG
Get precursor sequence
Structure
        10          20        30        40        50         
UUGAAGUAUGGUAGACA--|    GCAUAACGUA        UA         GGGUUUU 
                   CCUUG          GCAGCACA  AUGGUUUGU       \
                   GGAAC          CGUCGUGU  UACCGGACG       G
GAGAAGUCCUGCUACUUUA^    AUAAAAACUC        UA         UGGAAAA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-15-P1a_5p

MirBase accessionMIMAT0038410
Sequence
0- UAGCAGCACAUAAUGGUUUGUG -22
Get sequence
Star sequence

Cli-Mir-15-P1a_3p*

MirBase accessionMIMAT0038411
Sequence
37- CAGGCCAUAUUGUGCUGCCUCA -59
Get sequence