MirGeneDB

MirGeneDB ID

Mmu-Mir-15-P1a

Family name MIR-15 (all species)
Seed AGCAGCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-15a
Paralogues Mmu-Mir-15-P1b  Mmu-Mir-15-P1c  Mmu-Mir-15-P1d-v1  Mmu-Mir-15-P1d-v2  Mmu-Mir-15-P1d-v3  Mmu-Mir-15-P2a  Mmu-Mir-15-P2b  Mmu-Mir-15-P2c  Mmu-Mir-15-P2d 
Orthologues Ami-Mir-15-P1a  Bta-Mir-15-P1a  Cfa-Mir-15-P1a  Cin-Mir-15-P1  Cli-Mir-15-P1a  Cpi-Mir-15-P1a  Cpo-Mir-15-P1a  Dno-Mir-15-P1a  Dre-Mir-15-P1a1  Dre-Mir-15-P1a2  Ete-Mir-15-P1a  Gga-Mir-15-P1a  Hsa-Mir-15-P1a  Mdo-Mir-15-P1a  Mml-Mir-15-P1a  Oan-Mir-15-P1a  Ocu-Mir-15-P1a  Rno-Mir-15-P1a  Sha-Mir-15-P1a  Sto-Mir-15-P1a  Tgu-Mir-15-P1a  Xtr-Mir-15-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(mm10)
chr14: 61632038-61632096 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P1a)
Mir-15-P2a chr14: 61631893-61631957 [-] UCSC Ensembl
Mir-15-P1a chr14: 61632038-61632096 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGUUUUCAAAACCAACCCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUGUUGAAAAGGUGCAGGCCAUACUGUGCUGCCUCAAAAUACAAGGACCUGAUCUUCUGAAGAGAG
Get precursor sequence
Structure
        10           20        30        40        50         
GAGUUUUCAAAACCAAC---|    GAGUAAAGUA        UA         GGAUGUU 
                    CCUUG          GCAGCACA  AUGGUUUGU       \
                    GGAAC          CGUCGUGU  UACCGGACG       G
GAGAGAAGUCUUCUAGUCCA^    AUAAAACUC-        CA         UGGAAAA 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-15-P1a_5p

MirBase accessionMIMAT0000526
Sequence
0- UAGCAGCACAUAAUGGUUUGUG -22
Get sequence
Validated targets microrna.org: MIMAT0000526
TargetScanVert: mmu-miR-15a-5p
miRDB: MIMAT0000526
Star sequence

Mmu-Mir-15-P1a_3p*

MirBase accessionMIMAT0004624
Sequence
37- CAGGCCAUACUGUGCUGCCUCA -59
Get sequence
Validated targets microrna.org: MIMAT0004624
TargetScanVert: mmu-miR-15a-3p
miRDB: MIMAT0004624