MirGeneDB

MirGeneDB ID

Mmu-Mir-15-P2a

Family name MIR-15 (all species)
Seed AGCAGCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-16-1
Paralogues Mmu-Mir-15-P1a  Mmu-Mir-15-P1b  Mmu-Mir-15-P1c  Mmu-Mir-15-P1d-v1  Mmu-Mir-15-P1d-v2  Mmu-Mir-15-P1d-v3  Mmu-Mir-15-P2b  Mmu-Mir-15-P2c  Mmu-Mir-15-P2d 
Orthologues Ami-Mir-15-P2a  Bta-Mir-15-P2a  Cfa-Mir-15-P2a  Cin-Mir-15-P2  Cli-Mir-15-P2a  Cpi-Mir-15-P2a  Cpo-Mir-15-P2a  Dno-Mir-15-P2a  Dre-Mir-15-P2a1  Dre-Mir-15-P2a2  Ete-Mir-15-P2a  Gga-Mir-15-P2a  Hsa-Mir-15-P2a  Mdo-Mir-15-P2a  Mml-Mir-15-P2a  Oan-Mir-15-P2a  Ocu-Mir-15-P2a  Rno-Mir-15-P2a  Sha-Mir-15-P2a  Sto-Mir-15-P2a  Tgu-Mir-15-P2a  Xtr-Mir-15-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(mm10)
chr14: 61631893-61631957 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P2a)
Mir-15-P2a chr14: 61631893-61631957 [-] UCSC Ensembl
Mir-15-P1a chr14: 61632038-61632096 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCCUAUGAUAGCAAUGUCAGCGGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUGAAAUUACCUCCAGUAUUGACUGUGCUGCUGAAGUAAGGUUGGCAAUACUCUACAACUGUAAU
Get precursor sequence
Structure
        10          20        30         40        50        60 
GCUCCUAUGAUAGCAAU--      GG   C          -| A        CGUUAAGAUU 
                   GUCAGC  UGC UUAGCAGCAC GU AAUAUUGG          C
                   CGGUUG  AUG AGUCGUCGUG CA UUAUGACC          U
UAAUGUCAACAUCUCAUAA      GA   A          U^ G        UCCAUUAAAG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-15-P2a_5p

MirBase accessionMIMAT0000527
Sequence
0- UAGCAGCACGUAAAUAUUGGCG -22
Get sequence
Validated targets microrna.org: MIMAT0000527
TargetScanVert: mmu-miR-16-5p
miRDB: MIMAT0000527
Star sequence

Mmu-Mir-15-P2a_3p*

MirBase accessionMIMAT0004625
Sequence
42- CCAGUAUUGACUGUGCUGCUGAA -65
Get sequence
Validated targets microrna.org: MIMAT0004625
TargetScanVert: mmu-miR-16-1-3p
miRDB: MIMAT0004625