MirGeneDB

MirGeneDB ID

Rno-Mir-15-P2a

Family name MIR-15 (all species)
Seed AGCAGCA
Species Norway rat (Rattus norvegicus)
MiRBase ID
Paralogues Rno-Mir-15-P1a  Rno-Mir-15-P1b  Rno-Mir-15-P1c  Rno-Mir-15-P1d1  Rno-Mir-15-P1d2  Rno-Mir-15-P2b  Rno-Mir-15-P2c  Rno-Mir-15-P2d1  Rno-Mir-15-P2d2 
Orthologues Ami-Mir-15-P2a  Bta-Mir-15-P2a  Cfa-Mir-15-P2a  Cin-Mir-15-P2  Cli-Mir-15-P2a  Cpi-Mir-15-P2a  Cpo-Mir-15-P2a  Dno-Mir-15-P2a  Dre-Mir-15-P2a1  Dre-Mir-15-P2a2  Ete-Mir-15-P2a  Gga-Mir-15-P2a  Hsa-Mir-15-P2a  Mdo-Mir-15-P2a  Mml-Mir-15-P2a  Mmu-Mir-15-P2a  Oan-Mir-15-P2a  Ocu-Mir-15-P2a  Sha-Mir-15-P2a  Sto-Mir-15-P2a  Tgu-Mir-15-P2a  Xtr-Mir-15-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(rn6)
901866519: 341-405 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCCUAUGAUAGCGAUGUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUGAGAUUAUCUCCAGUAUUGACUGUGCUGCUGAAGUAAGGUUGACAAUACUCUACAACCGUAGU
Get precursor sequence
Structure
        10          20        30         40        50        60 
GCUCCUAUGAUAGCGAU--      AG   C          -| A        CGUUAAGAUU 
                   GUCAGC  UGC UUAGCAGCAC GU AAUAUUGG          C
                   CAGUUG  AUG AGUCGUCGUG CA UUAUGACC          U
UGAUGCCAACAUCUCAUAA      GA   A          U^ G        UCUAUUAGAG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-15-P2a_5p

MirBase accessionNone
Sequence
0- UAGCAGCACGUAAAUAUUGGCG -22
Get sequence
Star sequence

Rno-Mir-15-P2a_3p*

MirBase accessionNone
Sequence
42- CCAGUAUUGACUGUGCUGCUGAA -65
Get sequence