MirGeneDB

MirGeneDB ID

Sto-Mir-15-P2a

Family name MIR-15 (all species)
Seed CAAUAUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-15-P1a  Sto-Mir-15-P1b  Sto-Mir-15-P1c  Sto-Mir-15-P2b  Sto-Mir-15-P2c 
Orthologues Ami-Mir-15-P2a  Bta-Mir-15-P2a  Cfa-Mir-15-P2a  Cin-Mir-15-P2  Cli-Mir-15-P2a  Cpi-Mir-15-P2a  Cpo-Mir-15-P2a  Dno-Mir-15-P2a  Dre-Mir-15-P2a1  Dre-Mir-15-P2a2  Ete-Mir-15-P2a  Gga-Mir-15-P2a  Hsa-Mir-15-P2a  Mdo-Mir-15-P2a  Mml-Mir-15-P2a  Mmu-Mir-15-P2a  Oan-Mir-15-P2a  Ocu-Mir-15-P2a  Rno-Mir-15-P2a  Sha-Mir-15-P2a  Tgu-Mir-15-P2a  Xtr-Mir-15-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(miRNA_loci_genome)
BFAA01008186.1: 126338-126402 [+]
Precursor
(pre-Mir +30nt flank)
AAAUACAACAUUCUGAUGUCAGCAAUGCCUUAGCAGCAUGUAAAUAUUGGAGUUAAGCUCUUGUGAAAGUCCCCAAUAUUAAUUGUGCUGCUGGAGCAAGGCUGACUGCUUCUGCUGCUGCCAAA
Get precursor sequence
Structure
        10          20        30        40         50        60 
AAAUACAACAUUCUGAU--      AA   CU          UA-|       AGUUAAGCUC 
                   GUCAGC  UGC  UAGCAGCAUG   AAUAUUGG          U
                   CAGUCG  ACG  GUCGUCGUGU   UUAUAACC          U
AAACCGUCGUCGUCUUCGU      GA   AG          UAA^       CCUGAAAGUG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 on the 3p arm relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-15-P2a_5p*

MirBase accessionNone
Sequence
0- UAGCAGCAUGUAAAUAUUGGAG -22
Get sequence
Mature sequence

Sto-Mir-15-P2a_3p

MirBase accessionNone
Sequence
42- CCAAUAUUAAUUGUGCUGCUGGA -65
Get sequence