MirGeneDB

MirGeneDB ID

Ami-Mir-15-P1a

Family name MIR-15 (all species)
Seed AGCAGCA
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-15a
Paralogues Ami-Mir-15-P1b  Ami-Mir-15-P1c  Ami-Mir-15-P1d  Ami-Mir-15-P2a  Ami-Mir-15-P2b  Ami-Mir-15-P2d 
Orthologues Bta-Mir-15-P1a  Cfa-Mir-15-P1a  Cin-Mir-15-P1  Cli-Mir-15-P1a  Cpi-Mir-15-P1a  Cpo-Mir-15-P1a  Dno-Mir-15-P1a  Dre-Mir-15-P1a1  Dre-Mir-15-P1a2  Ete-Mir-15-P1a  Gga-Mir-15-P1a  Hsa-Mir-15-P1a  Mdo-Mir-15-P1a  Mml-Mir-15-P1a  Mmu-Mir-15-P1a  Oan-Mir-15-P1a  Ocu-Mir-15-P1a  Rno-Mir-15-P1a  Sha-Mir-15-P1a  Sto-Mir-15-P1a  Tgu-Mir-15-P1a  Xtr-Mir-15-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(allMis1)
JH737472: 9655-9713 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-15-P1a)
Mir-15-P2a JH737472: 9512-9576 [-] UCSC
Mir-15-P1a JH737472: 9655-9713 [-] UCSC
Precursor
(pre-Mir +30nt flank)
UUGAUGUUUAGUAGAUACCUUGGCCUAACGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGGGUUUCAUCUUCCUGAAGUG
Get precursor sequence
Structure
        10          20        30        40        50         
UUGAUGUUUAGUAGAUA--|    GCCUAACGUA        UA         GGAUUUU 
                   CCUUG          GCAGCACA  AUGGUUUGU       \
                   GGAAC          CGUCGUGU  UACCGGACG       G
GUGAAGUCCUUCUACUUUG^    AUAAAAACUC        UA         UGGAAAA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ami-Mir-15-P1a_5p

MirBase accessionMIMAT0038036
Sequence
0- UAGCAGCACAUAAUGGUUUGUG -22
Get sequence
Star sequence

Ami-Mir-15-P1a_3p*

MirBase accessionMIMAT0038037
Sequence
37- CAGGCCAUAUUGUGCUGCCUCA -59
Get sequence