| MirGeneDB ID | Ami-Mir-15-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-15 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | American alligator (Alligator mississippiensis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ami-mir-16b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ami-Mir-15-P1a Ami-Mir-15-P1b Ami-Mir-15-P1c Ami-Mir-15-P1d Ami-Mir-15-P2a Ami-Mir-15-P2b Ami-Mir-15-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-15-P2c Bta-Mir-15-P2c Cfa-Mir-15-P2c Cin-Mir-15-P2 Cja-Mir-15-P2c Cli-Mir-15-P2c Cmi-Mir-15-P2c Cpi-Mir-15-P2c Cpo-Mir-15-P2c Dno-Mir-15-P2c Dre-Mir-15-P2c-v1 Eca-Mir-15-P2c Ete-Mir-15-P2c Gga-Mir-15-P2c Gja-Mir-15-P2c Hsa-Mir-15-P2c Laf-Mir-15-P2c Lch-Mir-15-P2c Loc-Mir-15-P2c Mdo-Mir-15-P2c-v1 Mml-Mir-15-P2c Mmr-Mir-15-P2c Mmu-Mir-15-P2c Mun-Mir-15-P2c Neu-Mir-15-P2c-v1 Oan-Mir-15-P2c Ocu-Mir-15-P2c Pab-Mir-15-P2c Pbv-Mir-15-P2c Rno-Mir-15-P2c3 Rno-Mir-15-P2c4 Sha-Mir-15-P2c-v1 Spt-Mir-15-P2c Tgu-Mir-15-P2c Xla-Mir-15-P2c1 Xla-Mir-15-P2c2 Xtr-Mir-15-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Olfactores | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_000281125.3_ASM28112v4_AMI_add) |
NW_017711293.1: 2724727-2724792 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-15-P2c) |
Mir-15-P2c
NW_017711293.1: 2724727-2724792 [-]
UCSC
Mir-15-P1c NW_017711293.1: 2725269-2725326 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGCAGCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCUCUCCAAGCGGACGUGUCAGCAGUGCUCUAGCAGCACGUAAAUACUGGAGUCGAGGACUGCCUGGCUGCUCUCCAGUAUUGCAUUGCUGCUUGAGUGAGGCUGGAUCUCGGUGCCUGCCGCAGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CCUCUCCAAGCGGACGUG--| AG U CGUA UCGAGGACU UCAGC UGCUC AGCAGCA AAUACUGGAG G GGUCG GUGAG UCGUCGU UUAUGACCUC C GGACGCCGUCCGUGGCUCUA^ GA U UACG UCGUCGGUC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | The Dicer cut is -1 relative to most other vertebrates examined. Although there are some 3p reads there is no corresponding 5p read so the 3p arm is predicted and the 3' end of the 5p arm adjusted given orthologous sequences. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ami-Mir-15-P2c_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038045 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAGCAGCACGUAAAUACUGGAG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ami-Mir-15-P2c_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038046 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
44- CCAGUAUUGCAUUGCUGCUUGA -66
Get sequence
|
