MirGeneDB

MirGeneDB ID

Mmu-Mir-181-P2c

Family name MIR-181 (all species)
Seed ACAUUCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-181d
Paralogues Mmu-Mir-181-P1a  Mmu-Mir-181-P1b  Mmu-Mir-181-P1c  Mmu-Mir-181-P2a  Mmu-Mir-181-P2b 
Orthologues Aca-Mir-181-P2c  Ami-Mir-181-P2c  Bta-Mir-181-P2c  Cfa-Mir-181-P2c  Cpi-Mir-181-P2c  Dno-Mir-181-P2c  Dre-Mir-181-P2c1  Dre-Mir-181-P2c2  Ete-Mir-181-P2c  Hsa-Mir-181-P2c  Mdo-Mir-181-P2c  Mml-Mir-181-P2c  Oan-Mir-181-P2c  Ocu-Mir-181-P2c  Rno-Mir-181-P2c  Sha-Mir-181-P2c  Sto-Mir-181-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr8: 84178720-84178781 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2c)
Mir-181-P2c chr8: 84178720-84178781 [-] UCSC Ensembl
Mir-181-P1c chr8: 84178885-84178945 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGCCUCAGGCCACAGCAAAGGUCACAAUUAACAUUCAUUGUUGUCGGUGGGUUGUGAGGAGGCAGCCAGACCCACCGGGGGAUGAAUGUCACUGUGGCUGGGCCAAACAACACCAUCAGGG
Get precursor sequence
Structure
        10        20          30        40        50        60  
CUGCCUCAGGCCACAGCAAA--|      AUUA         G UG          GUGAGGA 
                      GGUCACA    ACAUUCAUU U  UCGGUGGGUU       \
                      UCGGUGU    UGUAAGUAG G  GGCCACCCAG       G
GGGACUACCACAACAAACCGGG^      CAC-         G --          ACCGACG 
120       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-181-P2c_5p

MirBase accessionMIMAT0004324
Sequence
0- AACAUUCAUUGUUGUCGGUGGGUU -24
Get sequence
Validated targets microrna.org: MIMAT0004324
TargetScanVert: mmu-miR-181d-5p
miRDB: MIMAT0004324
Star sequence

Mmu-Mir-181-P2c_3p*

MirBase accessionMIMAT0017264
Sequence
42- CCACCGGGGGAUGAAUGUCA -62
Get sequence
Validated targets TargetScanVert: mmu-miR-181d-3p
miRDB: MIMAT0017264